RegulonDB RegulonDB 10.9: Gene Sequence
sdhD gene sequence


Size: 348        A: 58  T: 112  G: 95  C: 83

Fasta

 

>sdhD E. coli K12. Version NC_000913.3 GI:556503834
atggtaagcaacgcctccgcattaggacgcaatggcgtacatgatttcatcctcgttcgc
gctaccgctatcgtcctgacgctctacatcatttatatggtcggttttttcgctaccagt
ggcgagctgacatatgaagtctggatcggtttcttcgcctctgcgttcaccaaagtgttc
accctgctggcgctgttttctatcttgatccatgcctggatcggcatgtggcaggtgttg
accgactacgttaaaccgctggctttgcgcctgatgctgcaactggtgattgtcgttgca
ctggtggtttacgtgatttatggattcgttgtggtgtggggtgtgtga
              
                            

Download fasta file
RegulonDB