RegulonDB RegulonDB 10.10: Gene Sequence
sdiA gene sequence


Size: 723        A: 200  T: 185  G: 182  C: 156

Fasta

 

>sdiA E. coli K12. Version NC_000913.3 GI:556503834
atgcaggataaggattttttcagctggcgtcgcacgatgctgttgcgttttcagaggatg
gagaccgcagaagaggtctaccatgaaattgagcttcaggctcagcagctggagtacgat
tactattcgttatgtgtccgccacccggtaccattcactcgacctaaagtggctttttac
accaattaccctgaggcgtgggttagttattatcaggcaaaaaactttctcgcaattgat
ccggtgctgaaccctgaaaactttagtcagggccatttaatgtggaatgatgacttattc
agcgaagcacagccgttatgggaagccgcgcgcgcacatggtttacgccgcggtgtcact
cagtatttaatgctgccaaaccgggcgctgggctttttgtccttttcccgttgcagcgcg
cgcgaaatacccattcttagtgatgaactgcaattaaaaatgcagttactggtgcgcgaa
agtctgatggctctgatgcgtttaaatgatgaaatagtgatgacgccagagatgaatttc
agcaagcgcgaaaaagaaattctgaggtggacggcggaagggaaaacatcagcagagata
gcgatgattttgtcaatctctgagaatacggtcaatttccaccagaaaaacatgcagaaa
aaaattaatgcaccaaataagacccaggttgcctgttacgcggccgctactggcttaatt
tga
              
                            

Download fasta file
RegulonDB