RegulonDB RegulonDB 11.1: Gene Sequence
secA gene sequence


Size: 2706        A: 720  T: 568  G: 749  C: 669

Fasta

 

>secA E. coli K12. Version NC_000913.3 GI:556503834
atgctaatcaaattgttaactaaagttttcggtagtcgtaacgatcgcaccctgcgccgg
atgcgcaaagtggtcaacatcatcaatgccatggaaccggagatggaaaaactctccgac
gaagaactgaaagggaaaaccgcagagtttcgtgcacgtctggaaaaaggcgaagtgctg
gaaaatctgatcccggaagctttcgccgtggtacgtgaggcaagtaagcgcgtctttggt
atgcgtcacttcgacgttcagttactcggcggtatggttcttaacgaacgctgcatcgcc
gaaatgcgtaccggtgaaggaaaaaccctgaccgcaacgctgcctgcttacctgaacgca
ctaaccggtaaaggcgtgcacgtagttaccgtcaacgactacctggcgcaacgtgacgcc
gaaaacaaccgtccgctgtttgaattccttggcctgactgtcggtatcaacctgccgggc
atgccagcaccggcaaagcgcgaagcttacgcagctgacatcacttacggtacgaacaac
gaatacggctttgactacctgcgcgacaacatggcgttcagccctgaagaacgtgtacag
cgtaaactgcactatgcgctggtggacgaagtggactccatcctgatcgatgaagcgcgt
acaccgctgatcatttccggcccggcagaagacagctcggaaatgtataaacgcgtgaat
aaaattattccgcacctgatccgtcaggaaaaagaagactccgaaaccttccagggcgaa
ggccacttctcggtggacgaaaaatctcgccaggtgaacctgaccgaacgtggtctggtg
ctgattgaagaactgctggtgaaagagggcatcatggatgaaggggagtctctgtactct
ccggccaacatcatgctgatgcaccacgtaacggcggcgctgcgcgctcatgcgctgttt
acccgtgacgtcgactacatcgttaaagatggtgaagttatcatcgttgacgaacacacc
ggtcgtaccatgcagggccgtcgctggtccgatggtctgcaccaggctgtggaagcgaaa
gaaggtgtgcagatccagaacgaaaaccaaacgctggcttcgatcaccttccagaactac
ttccgtctgtatgaaaaactggcggggatgaccggtactgctgataccgaagctttcgaa
tttagctcaatctacaagctggataccgtcgttgttccgaccaaccgtccaatgattcgt
aaagatctgccggacctggtctacatgactgaagcggaaaaaattcaggcgatcattgaa
gatatcaaagaacgtactgcgaaaggccagccggtgctggtgggtactatctccatcgaa
aaatcggagctggtgtcaaacgaactgaccaaagccggtattaagcacaacgtcctgaac
gccaaattccacgccaacgaagcggcgattgttgctcaggcaggttatccggctgcggtg
actatcgcgaccaatatggcgggtcgtggtacagatattgtgctcggtggtagctggcag
gcagaagttgccgcgctggaaaatccgaccgcagagcaaattgaaaaaattaaagccgac
tggcaggtacgtcacgatgcggtactggaagcaggtggcctgcatatcatcggtaccgag
cgtcacgaatcccgtcgtatcgataaccagttgcgcggtcgttctggtcgtcagggggat
gctggttcttcccgtttctacctgtcgatggaagatgcgctgatgcgtatttttgcttcc
gaccgagtatccggcatgatgcgtaaactgggtatgaagccaggcgaagccattgaacac
ccgtgggtgactaaagcgattgccaacgcccagcgtaaagttgaaagccgtaacttcgac
attcgtaagcaactgctggaatatgatgacgtggctaacgatcagcgtcgcgccatttac
tcccagcgtaacgaactgttggatgtcagcgatgtgagcgaaaccattaacagcattcgt
gaagatgtgttcaaagcgaccattgatgcctacattccaccacagtcgctggaagaaatg
tgggatattccggggctgcaggaacgtctgaagaacgatttcgacctcgatttgccaatt
gccgagtggctggataaagaaccagaactgcatgaagagacgctgcgtgagcgcattctg
gcgcagtccatcgaagtgtatcagcgtaaagaagaagtggttggtgctgagatgatgcgt
cacttcgagaaaggcgtcatgctgcaaacgcttgactccctgtggaaagagcacctggca
gcgatggactatctgcgtcagggtatccacctgcgtggctacgcacagaaagatccgaag
caggaatacaaacgtgaatcgttctccatgtttgcagcgatgctggagtcgttgaaatat
gaagttatcagtacgctgagcaaagttcaggtacgtatgcctgaagaggttgaggagctg
gaacaacagcgtcgtatggaagccgagcgtttagcgcaaatgcagcagcttagccatcag
gatgacgactctgcagccgcagctgcactggcggcgcaaaccggagagcgcaaagtagga
cgtaacgatccttgcccgtgcggttctggtaaaaaatacaagcagtgccatggccgcctg
caataa
              
                            

Download fasta file
RegulonDB