RegulonDB RegulonDB 10.9: Gene Sequence
secD gene sequence


Size: 1848        A: 439  T: 426  G: 515  C: 468

Fasta

 

>secD E. coli K12. Version NC_000913.3 GI:556503834
gtgttaaaccgttatcctttgtggaagtacgtcatgctgatcgtggtgattgtcatcggt
ctgctgtatgcgcttcccaacctgtttggtgaggatccggctgttcagatcactggtgcg
cgcggagtcgccgccagtgagcaaacgctgatccaggtccagaaaacgttacaagaagaa
aaaataactgctaagtctgtggcactggaagagggcgctattcttgcgcgcttcgactcc
actgacacccagttgcgcgctcgtgaagcattaatgggcgttatgggtgacaaatacgtc
gtggcgcttaaccttgccccggcaacgccgcgctggctggcagctattcacgctgagccg
atgaagctcggccttgacctgcgtggcggcgttcacttcctgatggaagtggatatggac
accgcgcttggcaaactccaggaacaaaatatcgatagcctacgcagtgacctgcgcgaa
aagggcatcccgtataccactgttcgtaaagaaaacaactacggcctgagcatcactttc
cgcgatgctaaagctcgtgatgaagccattgcgtatctgagcaagcgccatccggacctg
gtgattagcagccagggcagcaaccagctgcgtgcggtaatgagcgatgctcgtctgagt
gaagcgcgtgaatatgcggtgcagcagaacattaatatcctgcgtaaccgtgtaaaccaa
cttggcgtggcggagccggtggttcagcgtcagggtgctgaccgtatcgttgttgaactg
ccaggtattcaggacactgcgcgtgcgaaagagattctgggtgcgacggcaacgctggaa
ttccgtctggtaaacaccaacgttgaccaggccgctgcggcatccggtcgcgtaccgggc
gactctgaagtgaaacagacccgcgaaggtcagccagttgtgctgtacaaacgcgtaatt
ctgaccggtgaccatatcaccgactccacttccagccaggacgaatacaaccaaccgcag
gttaacatctcgctcgatagcgctggtggtaacatcatgtctaacttcactaaggacaac
atcggcaaaccgatggcaaccctgtttgtggagtacaaagacagcggtaagaaagatgca
aatggtcgtgcggttctggtgaaacaggaagaggtgattaacatcgccaacatccagtct
cgtctgggtaacagcttccgtatcaccggcatcaacaacccgaacgaagcccgtcagctg
tcactgctgctgcgtgccggtgcgttgatcgcgccgattcagattgttgaagaacgtacc
attggcccaaccctgggtatgcagaacattgaacaggggctggaggcttgccttgccggt
ctgctggtttctattctgttcatgatcatcttctataagaagtttggtctgattgcgacc
agtgctctgattgccaacttgatcttaatcgtcggcattatgtcgctgttgccaggcgca
acgctgagtatgccaggtatcgcgggtatcgtcttaacccttgcggtggcggtcgatgcg
aacgtactgatcaacgaacgtattaaagaagagttgagcaacggacgtactgttcaacag
gcaattgatgaaggttatcgtggcgcattcagttctatcttcgatgcgaacatcaccacg
ctgattaaagtcatcatcctgtacgcagtgggtaccggggcaattaaagggttcgcgatt
actaccggtatcggtgtggcgacgtcgatgtttaccgcgattgtcggtacgcgtgccatc
gtaaacctgctatatggcggcaagcgcgtcaagaagctgtcaatctga
              
                            

Download fasta file
RegulonDB