RegulonDB RegulonDB 10.9: Gene Sequence
selD gene sequence


Size: 1044        A: 240  T: 230  G: 320  C: 254

Fasta

 

>selD E. coli K12. Version NC_000913.3 GI:556503834
atgagcgagaactcgattcgtttgacccaatacagccacggagctggttgcggctgtaaa
atttccccaaaagtgttggaaaccatcctgcatagtgagcaggcgaagtttgttgatccg
aatttgcttgtgggtaatgaaacccgcgacgatgcggcggtgtacgatctgggcaatggc
accagcgttatcagtaccaccgacttctttatgccgatcgttgataatcctttcgatttt
ggccgcattgcggcgactaacgccatcagcgatatcttcgcgatggggggcaaaccgatt
atggcgattgcgatcctcggctggccgattaacaaactttccccagaaattgcccgcgaa
gtgaccgaaggtggacgctatgcatgtcgtcaggcgggtattgcgctggctggcggtcac
tccatcgatgcgccggagccgatttttggtctggcggtaacggggatcgtaccgaccgag
cgggtgaagaaaaacagtaccgcacaagccggatgcaaactgttcctgacgaaaccgctg
gggatcggcgttcttaccacggctgagaaaaaatcactgttgaaaccagaacatcaggga
ctggcgacggaagtgatgtgccggatgaacatcgcaggcgcgtcctttgccaacatcgaa
ggcgtaaaagcgatgaccgacgttacgggctttggtctgctgggccacttgagcgaaatg
tgtcagggggctggtgtgcaggcacgcgtcgactatgaagcgatcccgaaactccccggt
gttgaagagtacattaagttgggcgcagtacctggcggcactgaacgtaactttgccagc
tacggtcatctgatgggtgaaatgccgcgtgaagtgcgcgatctgctgtgtgatccgcaa
acttctggcggtttgctgctggcggtcatgccggaagcagaaaatgaggtcaaagctaca
gccgccgagtttggcattgaactgacggcaattggcgaactggtgccagcgcgcggcggt
cgtgccatggttgagattcgttaa
              
                            

Download fasta file
RegulonDB