RegulonDB RegulonDB 10.9: Gene Sequence
serC gene sequence


Size: 1089        A: 261  T: 282  G: 291  C: 255

Fasta

 

>serC E. coli K12. Version NC_000913.3 GI:556503834
atggctcaaatcttcaattttagttctggtccggcaatgctaccggcagaggtgcttaaa
caggctcaacaggaactgcgcgactggaacggtcttggtacgtcggtgatggaagtgagt
caccgtggcaaagagttcattcaggttgcagaggaagccgagaaggattttcgcgatctt
cttaatgtcccctccaactacaaggtattattctgccatggcggtggtcgcggtcagttt
gctgcggtaccgctgaatattctcggtgataaaaccaccgcagattatgttgatgccggt
tactgggcggcaagtgccattaaagaagcgaaaaaatactgcacgcctaatgtctttgac
gccaaagtgactgttgatggtctgcgcgcggttaagccaatgcgtgaatggcaactctct
gataatgctgcttatatgcattattgcccgaatgaaaccatcgatggtatcgccatcgac
gaaacgccagacttcggcgcagatgtggtggtcgccgctgacttctcttcaaccattctt
tcccgtccgattgacgtcagccgttatggtgtaatttacgctggcgcgcagaaaaatatc
ggcccggctggcctgacaatcgtcatcgttcgtgaagatttgctgggcaaagcgaatatc
gcgtgtccgtcgattctggattattccatcctcaacgataacggctccatgtttaacacg
ccgccgacatttgcctggtatctatctggtctggtctttaaatggctgaaagcgaacggc
ggtgtagctgaaatggataaaatcaatcagcaaaaagcagaactgctatatggggtgatt
gataacagcgatttctaccgcaatgacgtggcgaaagctaaccgttcgcggatgaacgtg
ccgttccagttggcggacagtgcgcttgacaaattgttccttgaagagtcttttgctgct
ggccttcatgcactgaaaggtcaccgtgtggtcggcggaatgcgcgcttctatttataac
gccatgccgctggaaggcgttaaagcgctgacagacttcatggttgagttcgaacgccgt
cacggttaa
              
                            

Download fasta file
RegulonDB