RegulonDB RegulonDB 10.9: Gene Sequence
sfsA gene sequence


Size: 705        A: 191  T: 166  G: 178  C: 170

Fasta

 

>sfsA E. coli K12. Version NC_000913.3 GI:556503834
atggaattttctccccctctacagcgcgcgacgctaattcagcgttacaaacgtttttta
gccgatgtgatcacacccgatggtcgcgaattaacgctacactgcccgaatacgggtgcg
atgaccggttgtgcaacgcctggcgataccgtctggtattcgacttcagacaacaccaaa
cggaaatacccacacacctgggaattaactcaaagccagagcggcgcatttatttgcgtc
aacacgctttgggctaacaggttgacgaaagaggctatccttaatgaatcaatttcagaa
ctgtcaggctatagctcgctgaaaagcgaagtaaaatacggcgcagaacgcagccgtatt
gactttatgttgcaggcggattcgcgtccagactgctatattgaagtgaaatcggttacg
ttagcggagaacgaacagggatattttcccgatgcggtcactgaacgaggtcagaaacac
cttcgggagttgatgagcgtagcggctgaaggccagcgtgcggttatctttttcgccgtg
ctgcattcagccattacacggttttcacccgcgcgccacatcgatgagaaatacgcgcaa
ctattgtcagaagctcaacagaggggggtagaaattctggcttacaaagcggaaatttct
gctgaaggcatggctcttaaaaaatcactgccggttacattgtag
              
                            

Download fasta file
RegulonDB