RegulonDB RegulonDB 10.9: Gene Sequence
bamE gene sequence


Size: 342        A: 90  T: 83  G: 84  C: 85

Fasta

 

>bamE E. coli K12. Version NC_000913.3 GI:556503834
atgcgctgtaaaacgctgactgctgcagcagcagtactattgatgttgaccgcaggctgt
tccactctggagcgagtggtttaccgtcctgacatcaaccaggggaactatctgaccgct
aacgacgtatccaaaatacgtgttggcatgacgcaacaacaagttgcgtacgcattgggt
acaccgctgatgtccgatccatttggtacgaatacctggttctatgtcttccgccagcaa
ccaggtcatgaaggtgtaactcagcaaacgctgacgctgacctttaacagtagcggtgtg
ttgaccaatattgataacaaacctgcgctgagtggtaactaa
              
                            

Download fasta file
RegulonDB