RegulonDB RegulonDB 10.10: Gene Sequence
sodB gene sequence


Size: 582        A: 150  T: 140  G: 140  C: 152

Fasta

 

>sodB E. coli K12. Version NC_000913.3 GI:556503834
atgtcattcgaattacctgcactaccatatgctaaagatgctctggcaccgcacatttct
gcggaaaccatcgagtatcactacggcaagcaccatcagacttatgtcactaacctgaac
aacctgattaaaggtaccgcgtttgaaggtaaatcactggaagagattattcgcagctct
gaaggtggcgtattcaacaacgcagctcaggtctggaaccatactttctactggaactgc
ctggcaccgaacgccggtggcgaaccgactggaaaagtcgctgaagctatcgccgcatct
tttggcagctttgccgatttcaaagcgcagtttactgatgcagcgatcaaaaactttggt
tctggctggacctggctggtgaaaaacagcgatggcaaactggctatcgtttcaacctct
aacgcgggtactccgctgaccaccgatgcgactccgctgctgaccgttgatgtctgggaa
cacgcttattacatcgactatcgcaatgcacgtcctggctatctggagcacttctgggcg
ctggtgaactgggaattcgtagcgaaaaatctcgctgcataa
              
                            

Download fasta file
RegulonDB