RegulonDB RegulonDB 10.9: Gene Sequence
sohB gene sequence


Size: 1050        A: 289  T: 230  G: 307  C: 224

Fasta

 

>sohB E. coli K12. Version NC_000913.3 GI:556503834
gtggaattgttgtctgaatatggtttgtttttggcgaaaatcgttaccgttgtgctagcg
attgcggcgattgccgccattattgtcaatgttgctcaacgtaataaacgccagcgtggc
gagttacgggtcaacaatctcagcgaacagtataaggagatgaaagaagaactggccgcg
gcgctgatggactcacatcagcaaaaacagtggcacaaagcgcagaagaaaaagcataag
caagaagcgaaagcagcaaaagcgaaagccaaactgggcgaggtggcaactgacagtaaa
ccccgcgtctgggtgctggattttaaaggcagcatggacgcccatgaagtgaactcgcta
cgtgaagagataacggctgtactcgcagcattcaaaccgcaggatcaggttgtgctccgt
ctggaaagccctggtggcatggtgcatggttacgggctggcggcttcgcaactgcagcgt
ctgcgcgataaaaacattcctttaactgttacggtagacaaagtcgctgccagcggcggt
tacatgatggcctgtgtggcggacaaaattgtttccgcaccgtttgctattgtgggttcc
attggcgtggtggcgcaaatgcccaactttaaccgcttcctgaaaagcaaagatattgat
atcgaactgcacactgccgggcagtataagcgcacgctgacgttgctgggtgaaaatacc
gaagaagggcgggagaaattccgcgaagagttgaacgaaacgcatcagttgtttaaagat
tttgtgaagcgtatgcgtccttctctggatattgaacaggtggcaacgggtgaacactgg
tacggacaacaggcggtagagaaaggcctggttgatgaaatcaacaccagtgatgaagtt
attcttagcctgatggaaggccgtgaagtggtcaatgtacgctatatgcagcgtaaacga
ctcattgaccgattcaccggcagcgcggcagagagcgccgatcgattgttgctacgctgg
tggcagcggggtcaaaagccattgatgtaa
              
                            

Download fasta file
RegulonDB