RegulonDB RegulonDB 10.9: Gene Sequence
soxR gene sequence


Size: 465        A: 117  T: 106  G: 141  C: 101

Fasta

 

>soxR E. coli K12. Version NC_000913.3 GI:556503834
atggaaaagaaattaccccgcattaaagcgctgctaacccccggcgaagtggcgaaacgc
agcggtgtggcggtatcggcgctgcatttctatgaaagtaaagggttgattaccagtatc
cgtaacagcggcaatcagcggcgatataaacgtgatgtgttgcgatatgttgcaattatc
aaaattgctcagcgtattggcattccgctggcgaccattggtgaagcgtttggcgtgttg
cccgaagggcatacgttaagtgcgaaagagtggaaacagctttcgtcccaatggcgagaa
gagttggatcggcgcattcataccttagtggcgctgcgtgacgaactggacggatgtatt
ggttgtggctgcctttcgcgcagtgattgcccgttgcgtaacccgggcgaccgcttagga
gaagaaggtaccggcgcacgcttgctggaagatgaacaaaactaa
              
                            

Download fasta file
RegulonDB