RegulonDB RegulonDB 10.9: Gene Sequence
speF gene sequence


Size: 2199        A: 547  T: 567  G: 556  C: 529

Fasta

 

>speF E. coli K12. Version NC_000913.3 GI:556503834
atgtcaaaattaaaaattgcggttagtgattcttgcccggactgttttaccacgcagcga
gaatgtatctacattaatgaaagtcgtaatatcgatgtggcggcaatagttttatcgctc
aacgatgttacatgcggaaaactcgatgaaatcgatgccacgggttatggcatcccggta
tttattgctactgaaaatcaagaacgtgtacccgcagagtatttgccccgtatttcgggt
gtctttgagaattgcgaatcgcgacgagaattttatggtcgccagttagaaaccgctgcc
agccattatgaaactcaactgcgcccacctttcttccgcgcactggtcgattatgtcaat
caaggtaacagcgcgtttgattgccctggtcatcagggcggcgaatttttccgtcgccat
ccggcggggaatcagtttgtggaatactttggtgaggcgctgttccgtgccgacttgtgc
aacgccgacgtagcgatgggcgatctgctgattcacgaaggcgcgccatgcattgcacag
caacatgcggcaaaagtgtttaatgccgataaaacctacttcgttttaaatggcacttca
tcttctaacaaagtggttttaaacgccctgctaacaccgggtgatctggtgctgtttgat
cgcaataaccacaaatctaaccaccacggagcgttgctacaggctggtgcaacaccggtt
tatctggaaacggcacgtaacccgtatggctttatcggtggcattgatgcgcactgtttt
gaagaaagttacctgcgtgagctgatcgcggaagtcgcaccgcagcgggcaaaagaggct
cgtcctttccgcctcgctgtgattcagttaggcacctacgacggtacgatttataacgcc
cgccaagtggtggataaaattggtcatctgtgtgactacatcctgtttgactcagcatgg
gtcggctatgaacagtttattccgatgatggcggactgttcgccgctgttgctggatctt
aatgagaacgatccgggtattctggttacgcaatctgtgcataaacaacaggctggtttt
tctcagacttcacaaattcataaaaaagacagccacatcaaagggcaacagcgttatgta
ccgcacaaacgcatgaacaacgcctttatgatgcacgcctccaccagcccgttctatccg
ctgtttgccgcactgaatatcaacgccaaaatgcatgaaggtgtcagcggtcgtaatatg
tggatggattgtgtggtaaatggcattaatgcccgcaaactgatcctcgataactgtcag
catattcgtccgttcgtacctgaactggtggatggtaaaccctggcagtcgtatgaaaca
gcgcaaattgcggttgatctgcgcttcttccagtttgtaccaggggaacactggcattct
tttgaaggctatgcagagaatcaatactttgtcgatccatgcaaactgttgctgacaacc
ccaggtattgatgcacgtaacggcgaatatgaagcgttcggtgtacccgcgacgattctt
gctaacttcctgcgcgaaaatggcgtagtgccggaaaaatgcgatcttaactccatcctc
ttcctgctgactccggcagaagatatggccaaacttcagcaacttgttgccctgctggta
cgcttcgaaaaactgcttgagtccgacgcgccattagcagaagtgctaccttccatctac
aaacagcatgaagagcgctacgccggttataccctgcgtcagttgtgtcaggaaatgcat
gatttgtatgcccgccacaacgtgaaacaactgcaaaaagagatgttccgtaaggagcac
ttcccacgcgtcagcatgaatccgcaagaagccaactacgcctatttacgcggtgaagtg
gaactggttcgtctgccggatgcagaaggccgtatcgctgccgaaggtgcgcttccttat
cctccgggtgtgctgtgtgttgttccgggtgaaatctggggtggtgctgttctgcgttac
ttcagcgctctggaagaagggatcaacctgctgccaggttttgcaccggagctgcagggt
gtctatatcgaagaacatgatggtcgtaagcaagtttggtgctatgtcatcaagcctcgt
gatgcgcaaagcaccctgttgaaaggggaaaaattatga
              
                            

Download fasta file
RegulonDB