RegulonDB RegulonDB 10.9: Gene Sequence
sppA gene sequence


Size: 1857        A: 440  T: 456  G: 517  C: 444

Fasta

 

>sppA E. coli K12. Version NC_000913.3 GI:556503834
atgcgaaccctttggcgatttattgccggattttttaaatggacgtggcgtctgctgaat
ttcgtccgtgaaatggtacttaacctgttctttattttcctcgtactggttggtgtgggg
atttggatgcaggtcagtggtggtgattcgaaagaaacggccagtcgtggcgcactgctg
ctggacatttctggtgtgatcgtcgataaacccgacagttctcagcggtttagtaaatta
agccgccagctgcttggtgccagttccgatcgtctgcaggaaaactcactgtttgatatc
gtcaacactattcgccaggcgaaggacgaccgcaatatcaccggtattgtgatggatctg
aaaaacttcgcaggcggcgaccaaccgtctatgcagtacatcggcaaagctctgaaagag
tttcgtgacagcgggaaaccggtttatgccgttggcgagaactacagccaggggcaatat
tatctcgccagtttcgccaataaaatttggctgtctccgcaaggcgtggttgatctgcac
ggctttgccaccaacggtctgtactacaaatcgttgctggataagctgaaagtttccacc
catgtgttccgcgtgggtacgtataaatctgccgttgaaccgtttattcgtgatgatatg
tcaccggcagcccgcgaagctgacagccgctggattggtgagctgtggcaaaactatctg
aatactgttgccgctaaccggcagatccctgctgagcaggtattccctggcgcgcaaggg
ttgcttgagggtttaaccaaaaccggtggcgataccgcgaaatatgcactggaaaacaag
ctggtcgatgcactggcatcgagtgcggaaatcgaaaaagcactgaccaaagaattcggc
tggagtaagactgataaaaattatcgcgccatcagttattacgattacgcattgaaaacg
ccggcagataccggtgacagcatcggtgtcgtctttgctaatggcgcaattatggatggc
gaggaaactcaggggaatgttggcggtgataccactgcggcacaaatccgcgacgctcgc
cttgacccgaaagtgaaagcgattgtcctgcgtgttaatagcccaggcggcagcgttacc
gcgtctgaagtgattcgcgctgaactggcagcagcccgggcagcgggtaagcctgtggtt
gtatcgatgggcggcatggcggcatctggtggttactggatttccacgccagctaattac
attgtggctaaccccagcaccctgaccggttctatcggtatcttcggcgtgatcaccacc
gtagaaaatagtctggattcgattggtgttcatactgatggtgtctcaacttcaccgctg
gcggatgtttctatcaccagggcactgccgccggaagcgcagctgatgatgcagttaagc
attgagaatggctataaacgctttatcacgctggttgctgatgcgcgtcattcgacgccg
gagcagattgataaaattgcccagggccacgtctggaccggtcaggatgcaaaagctaac
gggctggtcgatagtctcggggatttcgatgatgcggtcgccaaagcagcagagctggca
aaagtgaaacagtggcatctggaatattacgttgatgaaccgaccttcttcgacaaagtg
atggacaacatgtctggttctgtccgggcaatgttgccagatgcgttccaggccatgtta
cctgcaccgctggcctcggtagcctctaccgttaaaagtgaaagtgacaagctggccgcg
tttaatgacccacaaaaccgttatgcgttttgcctgacctgcgccaacatgcgttaa
              
                            

Download fasta file
RegulonDB