RegulonDB RegulonDB 10.9: Gene Sequence
srlB gene sequence


Size: 372        A: 76  T: 91  G: 101  C: 104

Fasta

 

>srlB E. coli K12. Version NC_000913.3 GI:556503834
atgaccgttatttatcagaccaccatcacccgtatcggcgcgagtgccattgacgccctc
agtgaccagatgctcatcacctttcgtgaaggcgcgcctgcggacctcgaagagtattgc
ttcattcattgccacggcgagttgaaaggtgcactccatcccggtttgcaattttcactc
gggcagcatcgctatccggtgaccgctgttggcagcgtggcggaagacaaccttcgcgaa
ctgggtcatgtcaccctgcgcttcgatggtttaaacgaagcggaatttccgggcactgtc
catgtggcaggccctgtccccgacgatatcgcgccgggatcggttttgaagtttgaatct
gttaaggagtaa
              
                            

Download fasta file
RegulonDB