RegulonDB RegulonDB 10.9: Gene Sequence
srlD gene sequence


Size: 780        A: 175  T: 189  G: 228  C: 188

Fasta

 

>srlD E. coli K12. Version NC_000913.3 GI:556503834
atgaatcaggttgccgttgtcatcggtggtgggcaaaccttaggcgcgttcctgtgccac
ggtctggctgccgaggggtatcgcgtcgcggttgtcgatattcagagcgacaaagccgca
aatgtggcacaagaaattaacgccgaatatggtgaaagtatggcgtacggttttggtgct
gacgccactagcgagcaaagcgttctggcgctctctcgtggggtagatgaaatctttggt
cgcgtggatttgctggtctacagcgccggaatagcaaaagcagcctttatcagcgacttc
cagctcggcgattttgaccgttcgctacaggtgaatctggtgggttatttcctgtgtgcg
cgtgaattttcgcgtttgatgatccgcgacgggattcaggggcgcattattcagatcaac
tcgaaatccggcaaagtgggcagcaaacacaactctggctacagcgcagcgaaatttggt
ggcgtcgggctgactcaatcactggcgctggatctggcggagtacggcattacggtgcat
tcactgatgctcggtaacctgctgaaatcgccgatgttccagtcactgttgccacaatac
gcgaccaagctgggtatcaaaccggatcaagtcgagcagtattacatcgacaaagtaccg
ctcaaacgcggctgcgattatcaagatgtgctgaatatgctgctgttctacgccagtcct
aaggcgtcgtactgcaccggacagtcgatcaatgtcaccggcggtcaggtgatgttctga
              
                            

Download fasta file
RegulonDB