RegulonDB RegulonDB 10.9: Gene Sequence
gutM gene sequence


Size: 360        A: 75  T: 87  G: 94  C: 104

Fasta

 

>gutM E. coli K12. Version NC_000913.3 GI:556503834
atggtatccgcactcatcaccgtcgccgttatcgcctggtgtgcgcaactggccttaggc
ggctggcaaatttctcgttttaaccgtgccttcgacacactatgccagcaagggcgggtt
ggcgtgggccgttccagcgggcgctttaaaccgcgggtcgtggtcgccatcgcgctggac
gatcagcagcgcatcgtcgacaccttgtttatgaaaggactgaccgtcttcgcccgaccg
caaaaaattcccgcaattaccggtatgcatgcgggtgatttacagcccgatgtgatcttt
ccccatgatccactatcacagaatgctctatcattggcgcttaaactgaaacgtggataa
              
                            

Download fasta file
RegulonDB