RegulonDB RegulonDB 10.9: Gene Sequence
srlR gene sequence


Size: 774        A: 213  T: 183  G: 193  C: 185

Fasta

 

>srlR E. coli K12. Version NC_000913.3 GI:556503834
atgaaacctcgtcagcgtcaggccgccattctggagtatctgcaaaagcagggtaaatgc
tcggttgaagaattggcgcaatactttgacaccacaggcacaaccattcgcaaagatctg
gtcattctggaacatgccggaaccgtcattcgtacttatggcggagtggtgttgaataaa
gaggaatccgatccgcctatcgatcataaaacactcatcaacacccacaagaaagagctg
attgcagaagctgccgttagttttatccatgatggcgattcgatcattcttgatgctggc
agtaccgttttgcagatggttcccctgctctcgcgctttaataacatcacggtgatgacc
aacagcctgcatatcgtcaatgcgctatccgaactggataacgaacaaactatcctgatg
ccaggcggaacgtttcgcaaaaaatcggcctcatttcacgggcaactggcagagaatgcc
ttcgagcatttcaccttcgataaattgtttatgggcaccgacggcatcgatctcaatgcg
ggcgtaaccacctttaacgaggtttataccgtcagtaaggcaatgtgcaatgccgcgcgc
gaagtgattttgatggcggactcatcaaagtttggccgtaaaagccccaacgtagtttgc
agtcttgaaagcgtcgataagctgattaccgacgcaggtatcgatccggcgtttcgtcag
gcgctggaagagaaagggatcgatgtgatcataaccggagagagcaatgagtga
              
                            

Download fasta file
RegulonDB