RegulonDB RegulonDB 10.9: Gene Sequence
srmB gene sequence


Size: 1335        A: 342  T: 262  G: 369  C: 362

Fasta

 

>srmB E. coli K12. Version NC_000913.3 GI:556503834
atgactgtaacgactttttccgaacttgaactcgacgaaagcctgctggaagccctccag
gataaaggtttcactcgcccgaccgccattcaggctgccgccattccgcctgcgctcgat
ggccgtgatgtactcggttctgcgccgacaggcaccggtaaaacggcggcgtatctgctg
ccagcgttgcagcacctgctcgatttcccgcgtaagaaatccggtccgccgcgtattttg
atcctcaccccaactcgcgagctggcgatgcaggtgtccgatcatgcccgcgaactggcg
aaacatacgcatctggatatcgccaccatcaccggcggcgtagcctatatgaaccacgcg
gaagtgttcagcgaaaatcaggacatcgtggtcgccacgaccggacgtctgctgcaatac
ataaaagaagagaacttcgattgccgcgcggttgaaacgctgatcctcgacgaagcagac
cgtatgctggatatgggcttcgctcaggatatcgaacatattgctggcgaaacgcgctgg
cgtaaacagaccctgctcttttcggcaacgctggaaggcgatgcgattcaggactttgcc
gagcgtctgctggaagatccggtggaagtttctgccaatccctccacccgtgagcgcaaa
aaaattcatcagtggtattaccgcgccgatgatcttgagcataaaaccgcgttgctggtg
catctgttaaaacagccggaagcgacccgctcaattgtgtttgtgcgtaagcgtgagcgt
gtgcatgagctggcaaactggctgcgcgaagcgggcatcaacaactgctatctcgaaggt
gagatggtacagggcaagcgtaacgaagcgatcaagcgtttgaccgaaggtcgcgtaaac
gtactggtcgcaaccgatgttgccgcgcgcggtatcgacattcctgacgtcagccacgtc
tttaacttcgatatgccgcgcagtggcgatacttatttgcaccgtatcggacgtaccgcg
cgcgccggtcgtaaaggcaccgcaatttcgctggtggaagcccatgaccatctgctgctg
ggtaaagtaggccgctatattgaagagccaattaaagctcgcgttattgatgagttacgc
ccgaaaacgcgtgcgccaagcgaaaagcagaccggcaagccatcgaagaaagtactggct
aaacgtgctgagaagaaaaaagctaaagagaaagagaagccgcgggtgaaaaaacgccat
cgcgacaccaaaaatattggtaagcgccgtaaaccaagcggaacgggcgtgccaccgcaa
acgacagaagagtaa
              
                            

Download fasta file
RegulonDB