RegulonDB RegulonDB 10.9: Gene Sequence
sucB gene sequence


Size: 1218        A: 292  T: 245  G: 358  C: 323

Fasta

 

>sucB E. coli K12. Version NC_000913.3 GI:556503834
atgagtagcgtagatattctggtccctgacctgcctgaatccgtagccgatgccaccgtc
gcaacctggcataaaaaacccggcgacgcagtcgtacgtgatgaagtgctggtagaaatc
gaaactgacaaagtggtactggaagtaccggcatcagcagacggcattctggatgcggtt
ctggaagatgaaggtacaacggtaacgtctcgtcagatccttggtcgcctgcgtgaaggc
aacagcgccggtaaagaaaccagcgccaaatctgaagagaaagcgtccactccggcgcaa
cgccagcaggcgtctctggaagagcaaaacaacgatgcgttaagcccggcgatccgtcgc
ctgctggctgaacacaatctcgacgccagcgccattaaaggcaccggtgtgggtggtcgt
ctgactcgtgaagatgtggaaaaacatctggcgaaagccccggcgaaagagtctgctccg
gcagcggctgctccggcggcgcaaccggctctggctgcacgtagtgaaaaacgtgtcccg
atgactcgcctgcgtaagcgtgtggcagagcgtctgctggaagcgaaaaactccaccgcc
atgctgaccacgttcaacgaagtcaacatgaagccgattatggatctgcgtaagcagtac
ggtgaagcgtttgaaaaacgccacggcatccgtctgggctttatgtccttctacgtgaaa
gcggtggttgaagccctgaaacgttacccggaagtgaacgcttctatcgacggcgatgac
gtggtttaccacaactatttcgacgtcagcatggcggtttctacgccgcgcggcctggtg
acgccggttctgcgtgatgtcgataccctcggcatggcagacatcgagaagaaaatcaaa
gagctggcagtcaaaggccgtgacggcaagctgaccgttgaagatctgaccggtggtaac
ttcaccatcaccaacggtggtgtgttcggttccctgatgtctacgccgatcatcaacccg
ccgcagagcgcaattctgggtatgcacgctatcaaagatcgtccgatggcggtgaatggt
caggttgagatcctgccgatgatgtacctggcgctgtcctacgatcaccgtctgatcgat
ggtcgcgaatccgtgggcttcctggtaacgatcaaagagttgctggaagatccgacgcgt
ctgctgctggacgtgtag
              
                            

Download fasta file
RegulonDB