RegulonDB RegulonDB 10.9: Gene Sequence
suhB gene sequence


Size: 804        A: 190  T: 176  G: 216  C: 222

Fasta

 

>suhB E. coli K12. Version NC_000913.3 GI:556503834
atgcatccgatgctgaacatcgccgtgcgcgcagcgcgcaaggcgggtaatttaattgcc
aaaaactatgaaaccccggacgctgtagaagcgagccagaaaggcagtaacgatttcgtg
accaacgtagataaagctgccgaagcggtgattatcgacacgattcgtaaatcttaccca
cagcacaccatcatcaccgaagaaagcggtgaacttgaaggtactgatcaggatgttcaa
tgggttatcgatccactggatggcactaccaactttatcaaacgtctgccgcacttcgcg
gtatctatcgctgttcgtatcaaaggccgcaccgaagttgctgtggtatacgatcctatg
cgtaacgaactgttcaccgccactcgcggtcagggcgcacagctgaacggctaccgactg
cgcggcagcaccgctcgcgatctcgacggtactattctggcgaccggcttcccgttcaaa
gcaaaacagtacgccactacctacatcaacatcgtcggcaaactgttcaacgaatgtgca
gacttccgtcgtaccggttctgcggcgctggatctggcttacgtcgctgcgggtcgtgtt
gacggtttctttgaaatcggtctgcgcccgtgggacttcgccgcaggcgagctgctggtt
cgtgaagcgggcggcatcgtcagcgacttcaccggtggtcataactacatgctgaccggt
aacatcgttgctggtaacccgcgcgttgttaaagccatgctggcgaacatgcgtgacgag
ttaagcgacgctctgaagcgttaa
              
                            

Download fasta file
RegulonDB