RegulonDB RegulonDB 10.9: Gene Sequence
tdcA gene sequence


Size: 939        A: 263  T: 280  G: 220  C: 176

Fasta

 

>tdcA E. coli K12. Version NC_000913.3 GI:556503834
atgagcactattcttcttccgaaaacgcagcacctggtagtctttcaggaagtcattaga
agtggttctatcggctcggctgcaaaagaattagggttaactcaaccggccgtcagtaaa
atcattaacgatattgaagattattttggtgtggaattagtggtgcggaaaaataccggt
gtaacattaacacctgccggtcaattgttactctcccgttccgaatccattacccgtgaa
atgaaaaatatggttaatgagataagcggtatgtcttctgaggcggtggtggaagtctca
tttggttttccttcattgattggttttacttttatgtcagggatgatcaacaagttcaaa
gaggtgttcccgaaagcgcaggtttctatgtatgaagcgcaactgtcttcgttcttaccg
gcaatccgcgacggtcgactggattttgcgattggtacgttaagtgcagaaatgaagctt
caggatttacatgttgagccgctgttcgagtccgagtttgtgctggtagccagtaagtcc
cgaacatgcaccggcaccaccacgctggagtcgttgaagaacgaacagtgggtgttgcca
caaactaatatggggtactacagcgaactgcttactacgttacaaagaaatggcatcagt
attgaaaacatcgttaaaaccgactcagtcgtgacaatttataatcttgttctcaatgct
gatttcttaactgtaattccttgtgatatgacgtcaccttttggttctaatcaatttatt
actattccggttgaagaaacattacctgtggcacaatatgccgcggtatggtcgaaaaat
tatcgtattaaaaaagcagcatcggttttggtggaattagccaaagagtattcatcttat
aatgggtgtagacgaaggcaattaatagaagttggttag
              
                            

Download fasta file
RegulonDB