RegulonDB RegulonDB 10.9: Gene Sequence
tdcB gene sequence


Size: 990        A: 271  T: 260  G: 245  C: 214

Fasta

 

>tdcB E. coli K12. Version NC_000913.3 GI:556503834
atgcatattacatacgatctgccggttgctattgatgacattattgaagcgaaacaacga
ctggctgggcgaatttataaaacaggcatgcctcgctccaactattttagtgaacgttgc
aaaggtgaaatattcctgaagtttgaaaatatgcagcgtacgggttcatttaaaattcgt
ggcgcatttaataaattaagttcactgaccgatgcggaaaaacgcaaaggcgtggtggcc
tgttctgcgggcaaccatgcgcaaggggtttccctctcctgcgcgatgctgggtatcgac
ggtaaagtggtgatgccaaaaggtgcgccaaaatccaaagtagcggcaacgtgcgactac
tccgcagaagtcgttctgcatggtgataacttcaacgacactatcgctaaagtgagcgaa
attgtcgaaatggaaggccgtatttttatcccaccttacgatgatccgaaagtgattgct
ggccagggaacgattggtctggaaattatggaagatctctatgatgtcgataacgtgatt
gtgccaattggtggtggcggtttaattgctggtattgcggtggcaattaaatctattaac
ccgaccattcgtgttattggcgtacagtctgaaaacgttcacggcatggcggcttctttc
cactccggagaaataaccacgcaccgaactaccggcaccctggcggatggttgtgatgtc
tcccgcccgggtaatttaacttacgaaatcgttcgtgaattagtcgatgacatcgtgctg
gtcagcgaagacgaaatcagaaacagtatgattgccttaattcagcgcaataaagtcgtc
accgaaggcgcaggcgctctggcatgtgctgcattattaagcggtaaattagaccaatat
attcaaaacagaaaaaccgtcagtattatttccggcggcaatatcgatctttctcgcgtc
tctcaaatcaccggtttcgttgacgcttaa
              
                            

Download fasta file
RegulonDB