RegulonDB RegulonDB 10.10: Gene Sequence
tdcC gene sequence


Size: 1332        A: 266  T: 402  G: 327  C: 337

Fasta

 

>tdcC E. coli K12. Version NC_000913.3 GI:556503834
atgagtacttcagatagcattgtatccagccagacaaaacaatcgtcctggcgtaaatca
gataccacatggacgttaggcttgtttggtacggcaatcggcgccggggtgctgttcttc
cctatccgcgcaggttttggcggactgatcccgattcttctgatgttggtattggcatac
cccatcgcgttttattgccaccgggcgctggcgcgtctgtgtctttctggctctaaccct
tccggcaacattacggaaacggtggaagagcattttggtaaaactggcggcgtggttatc
acgttcctgtacttcttcgcgatttgcccactgctgtggatttatggcgttactattacc
aatacctttatgacgttctgggaaaaccagctcggctttgcaccgctgaatcgcggcttt
gtggcgctgttcctgttgctgctgatggctttcgtcatctggtttggtaaggatctgatg
gttaaagtgatgagctacctggtatggccgtttatcgccagcctggtgctgatttctttg
tcgctgatcccttactggaactctgcagttatcgaccaggttgacctcggttcgctgtcg
ttaaccggtcatgacggtatcctgatcactgtctggctggggatttccatcatggttttc
tcctttaacttctcgccaatcgtctcttccttcgtggtttctaagcgtgaagagtatgag
aaagacttcggtcgcgacttcaccgaacgtaaatgttcccaaatcatttctcgtgccagc
atgctgatggttgcagtggtgatgttctttgcctttagctgcctgtttactctgtctccg
gccaacatggcggaagccaaagcgcagaatattccagtgctttcttatctggctaaccac
tttgcgtccatgaccggtaccaaaacaacgttcgcgattacactggaatatgcggcttcc
atcatcgcactcgtggctatcttcaaatctttcttcggtcactatctgggaacgctggaa
ggtctgaatggcctggtcctgaagtttggttataaaggcgacaaaactaaagtgtcgctg
ggtaaactgaacactatcagcatgatcttcatcatgggctccacctgggttgttgcctac
gccaacccgaacatccttgacctgattgaagccatgggcgcaccgattatcgcatccctg
ctgtgcctgttgccgatgtatgccatccgtaaagcgccgtctctggcgaaataccgtggt
cgtctggataacgtgtttgttaccgtgattggtctgctgaccatcctgaacatcgtatac
aaactgttttaa
              
                            

Download fasta file
RegulonDB