RegulonDB RegulonDB 10.10: Gene Sequence
tdcR gene sequence


Size: 219        A: 71  T: 85  G: 28  C: 35

Fasta

 

>tdcR E. coli K12. Version NC_000913.3 GI:556503834
atgagcaagttctcaaattttattataaataaaccattttcagtgataaataatgcggca
tgtcacattttttcacgctatttgttggagaacaaacatttattttatcaatattttaaa
atttcgaatacatgtattgatcatctcgaacaattgattaacgtcaactttttctcttct
gacaggacgtcattttgtgaatgcaatcgttttccataa
              
                            

Download fasta file
RegulonDB