RegulonDB RegulonDB 10.9: Gene Sequence
tdh gene sequence


Size: 1026        A: 230  T: 268  G: 292  C: 236

Fasta

 

>tdh E. coli K12. Version NC_000913.3 GI:556503834
atgaaagcgttatccaaactgaaagcggaagagggcatctggatgaccgacgttcctgta
ccggaactcgggcataacgatctgctgattaaaatccgtaaaacagccatctgcgggact
gacgttcacatctataactgggatgagtggtcgcaaaaaaccatcccggtgccgatggtc
gtgggccatgaatatgtcggtgaagtggtaggtattggtcaggaagtgaaaggcttcaag
atcggcgatcgcgtttctggcgaaggccatatcacctgtggtcattgccgcaactgtcgt
ggtggtcgtacccatttgtgccgcaacacgataggcgttggtgttaatcgcccgggctgc
tttgccgaatatctggtgatcccggcattcaacgccttcaaaatccccgacaatatttcc
gatgacttagccgcaatttttgatcccttcggtaacgccgtgcataccgcgctgtcgttt
gatctggtgggcgaagatgtgctggtttctggtgcaggcccgattggtattatggcagcg
gcggtggcgaaacacgttggtgcacgcaatgtggtgatcactgatgttaacgaataccgc
cttgagctggcgcgtaaaatgggtatcacccgtgcggttaacgtcgccaaagaaaatctc
aatgacgtgatggcggagttaggcatgaccgaaggttttgatgtcggtctggaaatgtcc
ggtgcgccgccagcgtttcgtaccatgcttgacaccatgaatcacggcggccgtattgcg
atgctgggtattccgccgtctgatatgtctatcgactggaccaaagtgatctttaaaggc
ttgttcattaaaggtatttacggtcgtgagatgtttgaaacctggtacaagatggcggcg
ctgattcagtctggcctcgatctttcgccgatcattacccatcgtttctctatcgatgat
ttccagaagggctttgacgctatgcgttcgggccagtccgggaaagttattctgagctgg
gattaa
              
                            

Download fasta file
RegulonDB