RegulonDB RegulonDB 10.9: Gene Sequence
tdk gene sequence


Size: 618        A: 178  T: 179  G: 143  C: 118

Fasta

 

>tdk E. coli K12. Version NC_000913.3 GI:556503834
atggcacagctatatttctactattccgcaatgaatgcgggtaagtctacagcattgttg
caatcttcatacaattaccaggaacgcggcatgcgcactgtcgtatatacggcagaaatt
gatgatcgctttggtgccgggaaagtcagttcgcgtataggtttgtcatcgcctgcaaaa
ttatttaaccaaaattcatcattatttgatgagattcgtgcggaacatgaacagcaggca
attcattgcgtactggttgatgaatgccagtttttaaccagacaacaagtatatgaatta
tcggaggttgtcgatcaactcgatatacccgtactttgttatggtttacgtaccgatttt
cgaggtgaattatttattggcagccaatacttactggcatggtccgacaaactggttgaa
ttaaaaaccatctgtttttgtggccgtaaagcaagcatggtgctgcgtcttgatcaagca
ggcagaccttataacgaaggtgagcaggtggtaattggtggtaatgaacgatacgtttct
gtatgccgtaaacactataaagaggcgttacaagtcgactcattaacggctattcaggaa
aggcatcgccacgattaa
              
                            

Download fasta file
RegulonDB