RegulonDB RegulonDB 11.0: Gene Sequence
tesB gene sequence


Size: 861        A: 196  T: 213  G: 229  C: 223

Fasta

 

>tesB E. coli K12. Version NC_000913.3 GI:556503834
atgagtcaggcgctaaaaaatttactgacattgttaaatctggaaaaaattgaggaagga
ctctttcgcggccagagtgaagatttaggtttacgccaggtgtttggcggccaggtcgtg
ggtcaggccttgtatgctgcaaaagagaccgtccctgaagagcggctggtacattcgttt
cacagctactttcttcgccctggcgatagtaagaagccgattatttatgatgtcgaaacg
ctgcgtgacggtaacagcttcagcgcccgccgggttgctgctattcaaaacggcaaaccg
attttttatatgactgcctctttccaggcaccagaagcgggtttcgaacatcaaaaaaca
atgccgtccgcgccagcgcctgatggcctcccttcggaaacgcaaatcgcccaatcgctg
gcgcacctgctgccgccagtgctgaaagataaattcatctgcgatcgtccgctggaagtc
cgtccggtggagtttcataacccactgaaaggtcacgtcgcagaaccacatcgtcaggtg
tggatccgcgcaaatggtagcgtgccggatgacctgcgcgttcatcagtatctgctcggt
tacgcttctgatcttaacttcctgccggtagctctacagccgcacggcatcggttttctc
gaaccggggattcagattgccaccattgaccattccatgtggttccatcgcccgtttaat
ttgaatgaatggctgctgtatagcgtggagagcacctcggcgtccagcgcacgtggcttt
gtgcgcggtgagttttatacccaagacggcgtactggttgcctcgaccgttcaggaaggg
gtgatgcgtaatcacaattaa
              
                            

Download fasta file
RegulonDB