RegulonDB RegulonDB 10.8: Gene Sequence
thrA gene sequence


Size: 2463        A: 553  T: 603  G: 692  C: 615

Fasta

 

>thrA E. coli K12. Version NC_000913.3 GI:556503834
atgcgagtgttgaagttcggcggtacatcagtggcaaatgcagaacgttttctgcgtgtt
gccgatattctggaaagcaatgccaggcaggggcaggtggccaccgtcctctctgccccc
gccaaaatcaccaaccacctggtggcgatgattgaaaaaaccattagcggccaggatgct
ttacccaatatcagcgatgccgaacgtatttttgccgaacttttgacgggactcgccgcc
gcccagccggggttcccgctggcgcaattgaaaactttcgtcgatcaggaatttgcccaa
ataaaacatgtcctgcatggcattagtttgttggggcagtgcccggatagcatcaacgct
gcgctgatttgccgtggcgagaaaatgtcgatcgccattatggccggcgtattagaagcg
cgcggtcacaacgttactgttatcgatccggtcgaaaaactgctggcagtggggcattac
ctcgaatctaccgtcgatattgctgagtccacccgccgtattgcggcaagccgcattccg
gctgatcacatggtgctgatggcaggtttcaccgccggtaatgaaaaaggcgaactggtg
gtgcttggacgcaacggttccgactactctgctgcggtgctggctgcctgtttacgcgcc
gattgttgcgagatttggacggacgttgacggggtctatacctgcgacccgcgtcaggtg
cccgatgcgaggttgttgaagtcgatgtcctaccaggaagcgatggagctttcctacttc
ggcgctaaagttcttcacccccgcaccattacccccatcgcccagttccagatcccttgc
ctgattaaaaataccggaaatcctcaagcaccaggtacgctcattggtgccagccgtgat
gaagacgaattaccggtcaagggcatttccaatctgaataacatggcaatgttcagcgtt
tctggtccggggatgaaagggatggtcggcatggcggcgcgcgtctttgcagcgatgtca
cgcgcccgtatttccgtggtgctgattacgcaatcatcttccgaatacagcatcagtttc
tgcgttccacaaagcgactgtgtgcgagctgaacgggcaatgcaggaagagttctacctg
gaactgaaagaaggcttactggagccgctggcagtgacggaacggctggccattatctcg
gtggtaggtgatggtatgcgcaccttgcgtgggatctcggcgaaattctttgccgcactg
gcccgcgccaatatcaacattgtcgccattgctcagggatcttctgaacgctcaatctct
gtcgtggtaaataacgatgatgcgaccactggcgtgcgcgttactcatcagatgctgttc
aataccgatcaggttatcgaagtgtttgtgattggcgtcggtggcgttggcggtgcgctg
ctggagcaactgaagcgtcagcaaagctggctgaagaataaacatatcgacttacgtgtc
tgcggtgttgccaactcgaaggctctgctcaccaatgtacatggccttaatctggaaaac
tggcaggaagaactggcgcaagccaaagagccgtttaatctcgggcgcttaattcgcctc
gtgaaagaatatcatctgctgaacccggtcattgttgactgcacttccagccaggcagtg
gcggatcaatatgccgacttcctgcgcgaaggtttccacgttgtcacgccgaacaaaaag
gccaacacctcgtcgatggattactaccatcagttgcgttatgcggcggaaaaatcgcgg
cgtaaattcctctatgacaccaacgttggggctggattaccggttattgagaacctgcaa
aatctgctcaatgcaggtgatgaattgatgaagttctccggcattctttctggttcgctt
tcttatatcttcggcaagttagacgaaggcatgagtttctccgaggcgaccacgctggcg
cgggaaatgggttataccgaaccggacccgcgagatgatctttctggtatggatgtggcg
cgtaaactattgattctcgctcgtgaaacgggacgtgaactggagctggcggatattgaa
attgaacctgtgctgcccgcagagtttaacgccgagggtgatgttgccgcttttatggcg
aatctgtcacaactcgacgatctctttgccgcgcgcgtggcgaaggcccgtgatgaagga
aaagttttgcgctatgttggcaatattgatgaagatggcgtctgccgcgtgaagattgcc
gaagtggatggtaatgatccgctgttcaaagtgaaaaatggcgaaaacgccctggccttc
tatagccactattatcagccgctgccgttggtactgcgcggatatggtgcgggcaatgac
gttacagctgccggtgtctttgctgatctgctacgtaccctctcatggaagttaggagtc
tga
              
                            

Download fasta file
RegulonDB