RegulonDB RegulonDB 10.9: Gene Sequence
thrB gene sequence


Size: 933        A: 195  T: 213  G: 294  C: 231

Fasta

 

>thrB E. coli K12. Version NC_000913.3 GI:556503834
atggttaaagtttatgccccggcttccagtgccaatatgagcgtcgggtttgatgtgctc
ggggcggcggtgacacctgttgatggtgcattgctcggagatgtagtcacggttgaggcg
gcagagacattcagtctcaacaacctcggacgctttgccgataagctgccgtcagaacca
cgggaaaatatcgtttatcagtgctgggagcgtttttgccaggaactgggtaagcaaatt
ccagtggcgatgaccctggaaaagaatatgccgatcggttcgggcttaggctccagtgcc
tgttcggtggtcgcggcgctgatggcgatgaatgaacactgcggcaagccgcttaatgac
actcgtttgctggctttgatgggcgagctggaaggccgtatctccggcagcattcattac
gacaacgtggcaccgtgttttctcggtggtatgcagttgatgatcgaagaaaacgacatc
atcagccagcaagtgccagggtttgatgagtggctgtgggtgctggcgtatccggggatt
aaagtctcgacggcagaagccagggctattttaccggcgcagtatcgccgccaggattgc
attgcgcacgggcgacatctggcaggcttcattcacgcctgctattcccgtcagcctgag
cttgccgcgaagctgatgaaagatgttatcgctgaaccctaccgtgaacggttactgcca
ggcttccggcaggcgcggcaggcggtcgcggaaatcggcgcggtagcgagcggtatctcc
ggctccggcccgaccttgttcgctctgtgtgacaagccggaaaccgcccagcgcgttgcc
gactggttgggtaagaactacctgcaaaatcaggaaggttttgttcatatttgccggctg
gatacggcgggcgcacgagtactggaaaactaa
              
                            

Download fasta file
RegulonDB