RegulonDB RegulonDB 10.9: Gene Sequence
thrC gene sequence


Size: 1287        A: 305  T: 302  G: 364  C: 316

Fasta

 

>thrC E. coli K12. Version NC_000913.3 GI:556503834
atgaaactctacaatctgaaagatcacaacgagcaggtcagctttgcgcaagccgtaacc
caggggttgggcaaaaatcaggggctgttttttccgcacgacctgccggaattcagcctg
actgaaattgatgagatgctgaagctggattttgtcacccgcagtgcgaagatcctctcg
gcgtttattggtgatgaaatcccacaggaaatcctggaagagcgcgtgcgcgcggcgttt
gccttcccggctccggtcgccaatgttgaaagcgatgtcggttgtctggaattgttccac
gggccaacgctggcatttaaagatttcggcggtcgctttatggcacaaatgctgacccat
attgcgggtgataagccagtgaccattctgaccgcgacctccggtgataccggagcggca
gtggctcatgctttctacggtttaccgaatgtgaaagtggttatcctctatccacgaggc
aaaatcagtccactgcaagaaaaactgttctgtacattgggcggcaatatcgaaactgtt
gccatcgacggcgatttcgatgcctgtcaggcgctggtgaagcaggcgtttgatgatgaa
gaactgaaagtggcgctagggttaaactcggctaactcgattaacatcagccgtttgctg
gcgcagatttgctactactttgaagctgttgcgcagctgccgcaggagacgcgcaaccag
ctggttgtctcggtgccaagcggaaacttcggcgatttgacggcgggtctgctggcgaag
tcactcggtctgccggtgaaacgttttattgctgcgaccaacgtgaacgataccgtgcca
cgtttcctgcacgacggtcagtggtcacccaaagcgactcaggcgacgttatccaacgcg
atggacgtgagtcagccgaacaactggccgcgtgtggaagagttgttccgccgcaaaatc
tggcaactgaaagagctgggttatgcagccgtggatgatgaaaccacgcaacagacaatg
cgtgagttaaaagaactgggctacacttcggagccgcacgctgccgtagcttatcgtgcg
ctgcgtgatcagttgaatccaggcgaatatggcttgttcctcggcaccgcgcatccggcg
aaatttaaagagagcgtggaagcgattctcggtgaaacgttggatctgccaaaagagctg
gcagaacgtgctgatttacccttgctttcacataatctgcccgccgattttgctgcgttg
cgtaaattgatgatgaatcatcagtaa
              
                            

Download fasta file
RegulonDB