RegulonDB RegulonDB 10.9: Gene Sequence
thrS gene sequence


Size: 1929        A: 519  T: 454  G: 504  C: 452

Fasta

 

>thrS E. coli K12. Version NC_000913.3 GI:556503834
atgcctgttataactcttcctgatggcagccaacgccattacgatcacgctgtaagcccc
atggatgttgcgctggacattggtccaggtctggcgaaagcctgtatcgcagggcgcgtt
aatggcgaactggttgatgcttgcgatctgattgaaaacgacgcacaactgtcgatcatt
accgccaaagacgaagaaggtctggagatcattcgtcactcctgtgcgcacctgttaggg
cacgcgattaaacaactttggccgcataccaaaatggcaatcggcccggttattgacaac
ggtttttattacgacgttgatcttgaccgcacgttaacccaggaagatgtcgaagcactc
gagaagcggatgcatgagcttgctgagaaaaactacgacgtcattaagaagaaagtcagc
tggcacgaagcgcgtgaaactttcgccaaccgtggggagagctacaaagtctccattctt
gacgaaaacatcgcccatgatgacaagccaggtctgtacttccatgaagaatatgtcgat
atgtgccgcggtccgcacgtaccgaacatgcgtttctgccatcatttcaaactaatgaaa
acggcaggggcttactggcgtggcgacagcaacaacaaaatgttgcaacgtatttacggt
acggcgtgggcagacaaaaaagcacttaacgcttacctgcagcgcctggaagaagccgcg
aaacgcgaccaccgtaaaatcggtaaacagctcgacctgtaccatatgcaggaagaagcg
ccgggtatggtattctggcacaacgacggctggaccatcttccgtgaactggaagtgttt
gttcgttctaaactgaaagagtaccagtatcaggaagttaaaggtccgttcatgatggac
cgtgtcctgtgggaaaaaaccggtcactgggacaactacaaagatgcaatgttcaccaca
tcttctgagaaccgtgaatactgcattaagccgatgaactgcccgggtcacgtacaaatt
ttcaaccaggggctgaagtcttatcgcgatctgccgctgcgtatggccgagtttggtagc
tgccaccgtaacgagccgtcaggttcgctgcatggcctgatgcgcgtgcgtggatttacc
caggatgacgcgcatatcttctgtactgaagaacaaattcgcgatgaagttaacggatgt
atccgtttagtctatgatatgtacagcacttttggcttcgagaagatcgtcgtcaaactc
tccactcgtcctgaaaaacgtattggcagcgacgaaatgtgggatcgtgctgaggcggac
ctggcggttgcgctggaagaaaacaacatcccgtttgaatatcaactgggtgaaggcgct
ttctacggtccgaaaattgaatttaccctgtatgactgcctcgatcgtgcatggcagtgc
ggtacagtacagctggacttctctttgccgtctcgtctgagcgcttcttatgtaggcgaa
gacaatgaacgtaaagtaccggtaatgattcaccgcgcaattctggggtcgatggaacgt
ttcatcggtatcctgaccgaagagttcgctggtttcttcccgacctggcttgcgccggtt
caggttgttatcatgaatattaccgattcacagtctgaatacgttaacgaattgacgcaa
aaactatcaaatgcgggcattcgtgttaaagcagacttgagaaatgagaagattggcttt
aaaatccgcgagcacactttgcgtcgcgtcccatatatgctggtctgtggtgataaagag
gtggaatcaggcaaagttgccgttcgcacccgccgtggtaaagacctgggaagcatggac
gtaaatgaagtgatcgagaagctgcaacaagagattcgcagccgcagtcttaaacaattg
gaggaataa
              
                            

Download fasta file
RegulonDB