RegulonDB RegulonDB 10.9: Gene Sequence
thyA gene sequence


Size: 795        A: 203  T: 186  G: 198  C: 208

Fasta

 

>thyA E. coli K12. Version NC_000913.3 GI:556503834
atgaaacagtatttagaactgatgcaaaaagtgctcgacgaaggcacacagaaaaacgac
cgtaccggaaccggaacgctttccatttttggtcatcagatgcgttttaacctgcaagat
ggattcccgctggtgacaactaaacgttgccacctgcgttccatcatccatgaactgctg
tggtttctgcagggcgacactaacattgcttatctacacgaaaacaatgtcaccatctgg
gacgaatgggccgatgaaaacggcgacctcgggccagtgtatggtaaacagtggcgcgcc
tggccaacgccagatggtcgtcatattgaccagatcactacggtactgaaccagctgaaa
aacgacccggattcgcgccgcattattgtttcagcgtggaacgtaggcgaactggataaa
atggcgctggcaccgtgccatgcattcttccagttctatgtggcagacggcaaactctct
tgccagctttatcagcgctcctgtgacgtcttcctcggcctgccgttcaacattgccagc
tacgcgttattggtgcatatgatggcgcagcagtgcgatctggaagtgggtgattttgtc
tggaccggtggcgacacgcatctgtacagcaaccatatggatcaaactcatctgcaatta
agccgcgaaccgcgtccgctgccgaagttgattatcaaacgtaaacccgaatccatcttc
gactaccgtttcgaagactttgagattgaaggctacgatccgcatccgggcattaaagcg
ccggtggctatctaa
              
                            

Download fasta file
RegulonDB