RegulonDB RegulonDB 10.8: Gene Sequence
ptrB gene sequence


Size: 2061        A: 509  T: 525  G: 527  C: 500

Fasta

 

>ptrB E. coli K12. Version NC_000913.3 GI:556503834
atgctaccaaaagccgcccgcattccccacgccatgacgcttcatggcgatacgcgcatc
gataattactactggctgcgggacgatacgcgttctcagccagaagtcctggactacctg
caacaagaaaatagttacggtcatcgggtgatggcctcacaacaagccttgcaggatcgc
atcttaaaggaaatcatcgaccgcattccgcaacgagaagtttctgcgccctacatcaaa
aatggctaccgctatcggcatatttatgaaccaggctgtgaatatgctatctaccagcgt
caatcggcattcagtgaagagtgggatgagtgggaaacattgctcgatgccaataagcgc
gcagctcatagtgagttttattcgatgggcggaatggcgattacgcccgataacaccatt
atggcgctggcagaagattttctttcccgacgccagtacggcattcgttttcgtaatctg
gaaactggtaactggtacccggaactgctggataacgttgaacccagctttgtctgggca
aatgactcctggattttctactatgttcgcaagcatccggtgacgctgctgccttatcag
gtctggcgtcacgccatcggtacgccagcatcgcaagataaactgatctacgaagaaaaa
gacgatacctattacgtcagcctgcataaaacgacctcgaagcactatgtagtcattcat
ttggccagcgccaccaccagtgaagttcgcctgctggacgcggaaatggccgatgccgag
ccgtttgtttttctgccgcgccgcaaagatcacgaatacagccttgatcactaccagcat
cgtttttatctgcgttccaaccgccacggcaaaaactttggcttataccgtacccgtatg
cgtgatgagcaacagtgggaagagttaattccgccacgcgaaaacatcatgctggaaggg
tttacgctgtttaccgactggctggtggttgaagagcgtcagcgcgggttaaccagtttg
cgccaaattaaccgcaagacccgggaagtcattggtattgcctttgatgatccggcctat
gtgacctggattgcctacaatccagaacctgaaaccgcgcgattgcgttatggttattct
tccatgactacaccagacactttgtttgaactggatatggataccggtgagcgtcgtgta
ttaaaacaaacggaagttcctggtttttatgcggcgaattaccgcagtgaacacctgtgg
atagtcgcccgtgatggcgtcgaagttccggtttcgttggtctaccatcgcaaacatttt
cgcaaaggacacaacccgttgctggtgtatggctatggttcttacggcgcaagtattgat
gccgatttcagttttagccgcttgagtttgttagatcgtggctttgtctacgccattgtc
catgttcgcggcggtggtgagctggggcaacaatggtacgaagacggaaaatttctgaag
aagaaaaatacgtttaatgattatcttgatgcctgcgatgcattgttaaaactgggctat
ggctctccttcgctttgttatgcgatgggcgggagtgcggggggcatgttgatgggcgtt
gcaattaatcaacgcccggaattattccacggcgttatcgcccaggtaccgtttgttgat
gttgtaacaacgatgcttgatgaatcaattcctcttaccactggtgagtttgaagagtgg
ggtaacccgcaggatccgcaatattacgagtacatgaaaagctacagcccgtatgacaac
gtcaccgcacaggcttatccgcatttactggtaacgaccggtttgcacgattctcaggtg
caatattgggaaccggcaaaatgggtcgctaaattgcgcgagctgaaaaccgatgaccat
cttttattgctctgtaccgacatggactcaggccatggcggtaaatctggtcgctttaaa
tcgtacgaaggcgtagcgatggaatatgcttttctggtcgcgctggcgcagggaacatta
cccgctacgcctgcggactaa
              
                            

Download fasta file
RegulonDB