RegulonDB RegulonDB 10.10: Gene Sequence
tnaB gene sequence


Size: 1248        A: 249  T: 419  G: 292  C: 288

Fasta

 

>tnaB E. coli K12. Version NC_000913.3 GI:556503834
atgactgatcaagctgaaaaaaagcactctgcattttggggtgttatggttatagcaggt
acagtaattggtggaggtatgtttgctttacctgttgatcttgccggtgcctggtttttc
tggggtgcctttatccttatcattgcctggttttcaatgcttcattccgggttattgtta
ttagaagcaaatttaaattatcccgtcggctccagttttaacaccatcaccaaagattta
atcggtaacacctggaacattatcagcggtattaccgttgccttcgttctctatatcctc
acttatgcctatatctctgctaatggtgcgatcattagtgaaacgatatcaatgaatttg
ggttatcacgctaatccacgtattgtcgggatctgcacagccattttcgttgccagcgta
ttgtggttaagttcgttagccgccagtcgtattacctcattgttcctcgggctgaagatt
atctcctttgtgatcgtgtttggttcttttttcttccaggtcgattactccattctgcgc
gacgccaccagctccactgcgggaacgtcttacttcccgtatatctttatggctttgccg
gtgtgtctggcgtcatttggtttccacggcaatattcccagcctgattatttgctatgga
aaacgcaaagataagttaatcaaaagcgtggtatttggttcgctgctggcgctggtgatt
tatctcttctggctctattgcaccatggggaatattccgcgagaaagctttaaggcgatt
atctcctcaggcggcaacgttgattcgctggtgaaatcgttcctcggcaccaaacagcac
ggcattatcgagttttgcctgctggtgttctctaacttagctgttgccagttcgttcttt
ggtgtcacgctggggttgttcgattatctggcggacctgtttaagattgataactcccac
ggcgggcgtttcaaaaccgtgctgttaaccttcctgccacctgcgttgttgtatctgatc
ttcccgaacggctttatttacgggatcggcggtgccgggctgtgcgccaccatctgggcg
gtcattattcccgcagtgcttgcaatcaaagctcgcaagaagtttcccaatcagatgttc
acggtctggggcggcaatcttattccggcgattgtcattctctttggtataaccgtgatt
ttgtgctggttcggcaacgtctttaacgtgttacctaaatttggctaa
              
                            

Download fasta file
RegulonDB