RegulonDB RegulonDB 10.9: Gene Sequence
tolA gene sequence


Size: 1266        A: 427  T: 177  G: 383  C: 279

Fasta

 

>tolA E. coli K12. Version NC_000913.3 GI:556503834
gtgtcaaaggcaaccgaacaaaacgacaagctcaagcgggcgataattatttcagcagtg
ctgcatgtcatcttatttgcggcgctgatctggagttcgttcgatgagaatatagaagct
tcagccggaggcggcggtggttcgtccatcgacgctgtcatggttgattcaggtgcggta
gttgagcagtacaaacgcatgcaaagccaggaatcaagcgcgaagcgttctgatgaacag
cgcaagatgaaggaacagcaggctgctgaagaactgcgtgagaaacaagcggctgaacag
gaacgcctgaagcaacttgagaaagagcggttagcggctcaggagcagaaaaagcaggct
gaagaagccgcaaaacaggccgagttaaagcagaagcaagctgaagaggcggcagcgaaa
gcggcggcagatgctaaagcgaaggccgaagcagatgctaaagctgcggaagaagcagcg
aagaaagcggctgcagacgcaaagaaaaaagcagaagcagaagccgccaaagccgcagcc
gaagcgcagaaaaaagccgaggcagccgctgcggcactgaagaagaaagcggaagcggca
gaagcagctgcagctgaagcaagaaagaaagcggcaactgaagctgctgaaaaagccaaa
gcagaagctgagaagaaagcggctgctgaaaaggctgcagctgataagaaagcggcagca
gagaaagctgcagccgacaaaaaagcagcagaaaaagcggctgctgaaaaggcagcagct
gataagaaagcagcggcagaaaaagccgccgcagacaaaaaagcggcagcggcaaaagct
gcagctgaaaaagccgctgcagcaaaagcggccgcagaggcagatgatattttcggtgag
ctaagctctggtaagaatgcaccgaaaacggggggaggggcgaaagggaacaatgcttcg
cctgccgggagtggtaatactaaaaacaatggcgcatcaggggccgatatcaataactat
gccgggcagattaaatctgctatcgaaagtaagttctatgacgcatcgtcctatgcaggc
aaaacctgtacgctgcgcataaaactggcacccgatggtatgttactggatatcaaacct
gaaggtggcgatcccgcactttgtcaggctgcgttggcagcagctaaacttgcgaagatc
ccgaaaccaccaagccaggcagtatatgaagtgttcaaaaacgcgccattggacttcaaa
ccgtaa
              
                            

Download fasta file
RegulonDB