RegulonDB RegulonDB 10.9: Gene Sequence
tolB gene sequence


Size: 1293        A: 279  T: 327  G: 361  C: 326

Fasta

 

>tolB E. coli K12. Version NC_000913.3 GI:556503834
atgaagcaggcattacgagtagcatttggttttctcatactgtgggcatcagttctgcat
gctgaagtccgcattgtgatcgacagcggtgtagattccggtcgtcctattggtgttgtt
cctttccagtgggcggggcctggtgcggcacctgaagatattggcggcatcgttgctgct
gacttgcgtaacagcggtaaatttaatccgttagatcgcgctcgtctgccacagcagccg
ggtagtgcgcaggaagtacaaccagctgcatggtccgcactgggcattgacgctgtagtt
gtcggtcaggtcactccgaatccggatggttcttacaatgttgcttatcaacttgttgac
actggcggcgcaccgggtactgtacttgctcagaactcgtacaaagtgaacaagcagtgg
ctgcgttatgctggtcataccgccagtgatgaagtgtttgaaaaactgaccggcattaaa
ggtgcgttccgtactcgtattgcctacgttgttcagaccaacggcggtcagttcccgtat
gaactgcgcgtatctgactatgacggttacaaccagtttgtcgttcaccgttcaccgcag
ccgctgatgtctccggcgtggtcaccagacggttctaaactggcttatgtgaccttcgaa
agcggtcgttccgcgctggttattcagacgctggcaaatggcgctgtacgtcaggtggct
tcattcccgcgtcacaacggtgcacctgcattctcgccagacggcagcaaactggcattc
gccttgtcgaaaaccggtagtctgaacctgtacgtaatggatttggcttctggtcagatc
cgccaggtgactgatggtcgcagtaacaataccgaaccgacctggttcccggatagccag
aacctggcatttacttctgaccaggccggtcgtccgcaggtttataaagtgaatatcaac
ggcggtgcgccacaacgtattacctgggaaggttcgcagaaccaggatgcggatgtcagc
agcgacggtaaatttatggtaatggtcagctccaatggtgggcagcagcacattgccaaa
caagatctggcaacgggaggcgtacaagttctgtcgtccacgttcctggatgaaacgcca
agtctggcacctaacggcactatggtaatctacagctcttctcaggggatgggatccgtg
ctgaatttggtttctacagatgggcgtttcaaagcgcgtcttccggcaactgatggacag
gtcaaattccctgcctggtcgccgtatctgtga
              
                            

Download fasta file
RegulonDB