RegulonDB RegulonDB 10.9: Gene Sequence
tolC gene sequence


Size: 1482        A: 398  T: 323  G: 361  C: 400

Fasta

 

>tolC E. coli K12. Version NC_000913.3 GI:556503834
atgaagaaattgctccccattcttatcggcctgagcctttctgggttcagttcgttgagc
caggccgagaacctgatgcaagtttatcagcaagcacgccttagtaacccggaattgcgt
aagtctgccgccgatcgtgatgctgcctttgaaaaaattaatgaagcgcgcagtccatta
ctgccacagctaggtttaggtgcagattacacctatagcaacggctaccgcgacgcgaac
ggcatcaactctaacgcgaccagtgcgtccttgcagttaactcaatccatttttgatatg
tcgaaatggcgtgcgttaacgctgcaggaaaaagcagcagggattcaggacgtcacgtat
cagaccgatcagcaaaccttgatcctcaacaccgcgaccgcttatttcaacgtgttgaat
gctattgacgttctttcctatacacaggcacaaaaagaagcgatctaccgtcaattagat
caaaccacccaacgttttaacgtgggcctggtagcgatcaccgacgtgcagaacgcccgc
gcacagtacgataccgtgctggcgaacgaagtgaccgcacgtaataaccttgataacgcg
gtagagcagctgcgccagatcaccggtaactactatccggaactggctgcgctgaatgtc
gaaaactttaaaaccgacaaaccacagccggttaacgcgctgctgaaagaagccgaaaaa
cgcaacctgtcgctgttacaggcacgcttgagccaggacctggcgcgcgagcaaattcgc
caggcgcaggatggtcacttaccgactctggatttaacggcttctaccgggatttctgac
acctcttatagcggttcgaaaacccgtggtgccgctggtacccagtatgacgatagcaat
atgggccagaacaaagttggcctgagcttctcgctgccgatttatcagggcggaatggtt
aactcgcaggtgaaacaggcacagtacaactttgtcggtgccagcgagcaactggaaagt
gcccatcgtagcgtcgtgcagaccgtgcgttcctccttcaacaacattaatgcatctatc
agtagcattaacgcctacaaacaagccgtagtttccgctcaaagctcattagacgcgatg
gaagcgggctactcggtcggtacgcgtaccattgttgatgtgttggatgcgaccaccacg
ttgtacaacgccaagcaagagctggcgaatgcgcgttataactacctgattaatcagctg
aatattaagtcagctctgggtacgttgaacgagcaggatctgctggcactgaacaatgcg
ctgagcaaaccggtttccactaatccggaaaacgttgcaccgcaaacgccggaacagaat
gctattgctgatggttatgcgcctgatagcccggcaccagtcgttcagcaaacatccgca
cgcactaccaccagtaacggtcataaccctttccgtaactga
              
                            

Download fasta file
RegulonDB