RegulonDB RegulonDB 10.9: Gene Sequence
tolQ gene sequence


Size: 693        A: 164  T: 179  G: 182  C: 168

Fasta

 

>tolQ E. coli K12. Version NC_000913.3 GI:556503834
gtgactgacatgaatatccttgatttgttcctgaaggctagccttctggttaaacttatc
atgttgattttgattggtttttcaatcgcatcttgggccattattatccagcggacccgt
attcttaacgcagcggcgcgcgaagccgaagcgtttgaagataaattctggtctggaatc
gaactctctcgcctctatcaagagagccaggggaaacgggataatctgactggttcggaa
caaatcttttacagcgggttcaaagagtttgtgcgcctgcatcgtgccaatagccatgcg
ccggaagccgtagtggaaggggcgtcgcgtgctatgcgtatctccatgaaccgtgaactt
gaaaatctggaaacgcacattccgttcctcggtacggttggctccatcagcccgtatatt
ggtctgtttggtacggtctgggggatcatgcacgcctttatcgccctcggggcggtaaaa
caagcaacactgcaaatggttgcgcccggtatcgcagaagcgttgattgcgactgcaatt
ggtctgtttgccgctatcccggcagttatggcctacaaccgcctcaaccagcgcgtaaac
aaactggaactgaattacgacaactttatggaagagtttaccgcgattctgcaccgccag
gcgtttaccgttagcgagagcaacaaggggtaa
              
                            

Download fasta file
RegulonDB