RegulonDB RegulonDB 10.9: Gene Sequence
tolR gene sequence


Size: 429        A: 104  T: 103  G: 126  C: 96

Fasta

 

>tolR E. coli K12. Version NC_000913.3 GI:556503834
atggccagagcgcgtggacgaggtcgtcgcgatctcaagtccgaaatcaacattgtaccg
ttgctggacgtactgctggtgctgttgctgatctttatggcgacagcgcccatcatcacc
cagagcgtggaggtcgatctgccagacgctactgaatcacaggcggtgagcagtaacgat
aatccgccagtgattgttgaagtgtctggtattggtcagtacaccgtggtggttgagaaa
gatcgcctggagcgtttaccaccagagcaggtggtggcggaagtgtccagccgtttcaag
gccaacccgaaaacggtctttctgatcggtggcgcaaaagatgtgccttacgatgaaata
attaaagcactgaacttgttacatagtgcgggtgtgaaatcggttggtttaatgacgcag
cctatctaa
              
                            

Download fasta file
RegulonDB