RegulonDB RegulonDB 10.9: Gene Sequence
tonB gene sequence


Size: 720        A: 186  T: 142  G: 194  C: 198

Fasta

 

>tonB E. coli K12. Version NC_000913.3 GI:556503834
atgacccttgatttacctcgccgcttcccctggccgacgttactttcggtctgcattcat
ggtgctgttgtggcgggtctgctctatacctcggtacatcaggttattgaactacctgcg
cctgcgcagccgatttctgtcacgatggttacgcctgctgatctcgaaccgccacaagcc
gttcagccgccaccggagccggtggtagagccagaaccggaacctgagccgatccccgaa
ccgccaaaagaagcaccggtggtcattgaaaagccgaagccgaaacctaagccaaaaccg
aagccggtgaaaaaggtacaggagcagccaaaacgcgatgtcaaacccgtagagtcgcgt
ccggcatcaccgtttgaaaatacggcaccggcacgcctgacatcaagtacagcaacggct
gcaaccagcaagccggttaccagtgtggcttcaggaccacgcgcattaagccgtaatcag
ccgcagtatccggcacgagcacaggcattgcgcattgaagggcaggttaaagttaaattt
gacgttacgccggatggtcgcgtggataacgtacaaatcctctcagccaagcctgcgaac
atgtttgagcgtgaggtgaaaaatgcgatgcgcagatggcgttatgagccgggtaagcca
ggcagtgggattgtggtgaatatcctgtttaaaattaacggcaccaccgaaattcagtaa
              
                            

Download fasta file
RegulonDB