RegulonDB RegulonDB 10.9: Gene Sequence
topA gene sequence


Size: 2598        A: 695  T: 558  G: 721  C: 624

Fasta

 

>topA E. coli K12. Version NC_000913.3 GI:556503834
atgggtaaagctcttgtcatcgttgagtccccggcaaaagccaaaacgatcaacaagtat
ctgggtagtgactacgtggtgaaatccagcgtcggtcacatccgcgatttgccgaccagt
ggctcagctgccaaaaagagtgccgactctacctccaccaagacggctaaaaagcctaaa
aaggatgaacgtggcgctctcgtcaaccgtatgggggttgacccgtggcacaattgggag
gcgcactatgaagtgttgcctggtaaagagaaggtcgtctctgaactgaaacaactggct
gaaaaagccgaccacatctatctcgcaaccgaccttgaccgcgaaggggaagccattgca
tggcacctgcgggaagtgattgggggtgatgatgcgcgctatagccgagtggtgtttaac
gaaattactaaaaacgcgatccgccaggcatttaacaaaccgggtgagctgaatattgat
cgtgttaatgcccagcaggcgcgtcgctttatggaccgcgtggtggggtatatggtttcg
ccgctgctatggaaaaagatcgctcgtggcctgtctgccggtcgtgtgcagtcggtggcg
gttcgcctggtggtcgagcgtgagcgtgaaattaaagcgttcgtgccggaagagttctgg
gaagtcgatgccagcacgaccacgccatctggtgaagcgttggcgttacaggtgactcat
cagaacgacaaaccgttccgtccggtcaacaaagaacaaactcaggctgcggtaagtctg
ctggaaaaagcgcgctacagcgtgctggaacgtgaagacaaaccgacaaccagtaaacct
ggcgctccttttattacctctacgctgcaacaagctgccagcacccgtcttggatttggc
gtgaaaaaaaccatgatgatggcgcagcgtttgtatgaagcaggctatatcacttacatg
cgtaccgactccactaacctgagtcaggacgcggtaaatatggttcgcggttatatcagc
gataattttggtaagaaatatctgccggaaagtccgaatcagtacgccagcaaagaaaac
tcacaggaagcgcacgaagcgattcgtccttctgacgtcaatgtgatggcggaatcgctg
aaggatatggaagcagatgcgcagaaactgtaccagttaatctggcgtcagttcgttgcc
tgccagatgaccccagcgaaatatgactccacgacgctgaccgttggtgcgggcgatttc
cgcctgaaagcacgcggtcgtattttgcgttttgatggctggacaaaagtgatgcctgcg
ttgcgtaaaggcgatgaagatcgcatcttaccagcagttaataaaggcgatgctctgacg
ctcgttgaacttacaccagcccagcactttaccaagccgccagcccgtttcagtgaagca
tcgctggttaaagagctggaaaaacgcggtatcggtcgtccgtctacctatgcgtcgatc
atttcgaccattcaggatcgtggctacgtgcgagtagaaaatcgtcgtttctatgcggaa
aaaatgggcgaaatcgtcaccgatcgccttgaagaaaatttccgcgagttaatgaactac
gactttaccgcgcagatggaaaacagcctcgaccaggtggcaaatcacgaagcagagtgg
aaagctgtactggatcacttcttctcggatttcacccagcagttagataaagctgaaaaa
gatccggaagagggtggtatgcgcccgaaccagatggttctgaccagcattgactgcccg
acttgtggtcgcaaaatggggattcgcacagcgagcaccggggtattccttggctgttct
ggctatgcgctgccgccgaaagagcgttgcaaaaccaccattaacctggtgccggaaaac
gaagtgctgaacgtgctggaaggcgaagatgctgaaaccaacgcgctgcgcgcaaaacgt
cgttgcccgaaatgcggcacggcgatggacagctatctcatcgatccgaaacgtaagttg
catgtctgtggtaataacccaacctgcgacggttacgagatcgaagagggcgaattccgc
attaaaggttatgacggcccgatcgttgagtgtgaaaaatgtggctctgaaatgcacctg
aaaatggggcgtttcggtaaatacatggcctgcaccaacgaagagtgtaaaaacacacgt
aagattttacgtaacggcgaagtggcaccaccgaaagaagatccggtgccattacctgag
ctgccgtgcgaaaaatcagatgcttatttcgtgctgcgtgacggtgctgccggtgtgttc
ctggctgccaacactttcccgaaatcgcgtgaaacgcgtgcgccactggtggaagagctt
tatcgcttccgcgaccgtctgccggaaaaactgcgttatctggccgatgcgccacagcag
gatccggaaggtaataagaccatggttcgctttagccgtaaaaccaaacagcaatatgtc
tcttcggaaaaagacggaaaggcgactggctggtcagcattttatgttgatggcaaatgg
gttgaaggaaaaaaataa
              
                            

Download fasta file
RegulonDB