RegulonDB RegulonDB 10.9: Gene Sequence
tpr gene sequence


Size: 90        A: 23  T: 9  G: 32  C: 26

Fasta

 

>tpr E. coli K12. Version NC_000913.3 GI:556503834
atgagaagcttcgaccaaggttcgactcgagcgccagcgagagagcgttgccgcaggcaa
cgacccgaagggcgaagcgcgcagcgctga
              
                            

Download fasta file
RegulonDB