RegulonDB RegulonDB 10.9: Gene Sequence
trg gene sequence


Size: 1641        A: 428  T: 372  G: 461  C: 380

Fasta

 

>trg E. coli K12. Version NC_000913.3 GI:556503834
atgaatacaactccctcacagcgattaggttttttgcatcacatcaggttggttccgtta
tttgcctgcattctaggcggtatcttagttctattcgcattaagttcagccctggctggc
tatttcctctggcaggccgatcgcgatcagcgtgatgttactgcggagattgagattcgg
accgggttagcgaacagttcagattttttgcgttcagcccggatcaatatgattcaggcc
ggggctgcgagtcgtattgcggaaatggaagcaatgaagcgaaatattgcgcaagccgaa
tcggagattaaacagtcgcagcaaggttatcgtgcttatcagaatcgaccggtgaaaaca
cctgctgatgaagccctcgacactgaattaaatcaacgctttcaggcttatatcacgggt
atgcaacctatgttgaaatatgccaaaaatggcatgtttgaagcgattatcaatcatgaa
agtgagcagatccgaccgctggataatgcttataccgatattttgaacaaagccgttaag
atacgtagcaccagagccaaccaactggcggaactggcccatcagcgcacccgcctgggt
gggatgttcatgattggcgcgtttgtgcttgccctggtcatgacgctgataacatttatg
gtgctacgtcggatcgtcattcgtccactgcaacatgccgcacaacggattgaaaaaatc
gccagtggcgatctgacgatgaatgatgaaccggcgggtcgtaatgaaatcggtcgctta
agtcgtcatttacagcaaatgcagcattcactggggatgacagtagggactgttcgacag
ggcgcggaagagatttatcgtggcaccagcgaaatttcagctggcaatgcggacctgtca
tctcgcaccgaagaacaagcggcggctatcgaacaaactgccgccagcatggagcaactc
actgcgacggtgaaacagaatgcggataacgcgcatcatgccagcaaactggcgcaagag
gcttctattaaagccagcgatggcgggcagacggtttccggtgtagtaaaaacgatgggc
gctatctccacgagttcgaagaaaatttctgagatcaccgccgtcatcaacagtattgct
ttccagacgaatattctggcactgaatgctgccgttgaagccgcgcgagcgggtgagcaa
gggcgtggatttgccgttgtcgccagcgaagtacggacactcgcaagtcgcagcgctcag
gcggcgaaagagattgaaggcttgatcagtgaatcagtcaggttaattgacctggggtcg
gatgaggtggcaacggccgggaaaaccatgagcactattgttgatgccgtcgcgagtgtc
acacatatcatgcaggaaatcgccgccgcctcggatgaacaaagtagaggcataacgcag
gttagccaggcgatttctgaaatggataaggtgacgcaacagaatgcttctctggtagaa
gaggcctcagcggcggcggtgtcccttgaagaacaggcggcacgattaactgaggcggtg
gatgtattccgtctgcacaaacattctgtgtcggcagaacctcgcggagcgggtgaacca
gttagtttcgctacggtgtga
              
                            

Download fasta file
RegulonDB