RegulonDB RegulonDB 10.9: Gene Sequence
trkG gene sequence


Size: 1458        A: 342  T: 561  G: 321  C: 234

Fasta

 

>trkG E. coli K12. Version NC_000913.3 GI:556503834
atgaatacatctcatgtaagagttgttactcatatgtgtgggttcctggtttggctctat
agtctttcaatgttgccaccaatggttgtagcattgttttataaagaaaaaagcctgttt
gttttctttataactttcgttatatttttttgcattggtggcggagcgtggtatacaact
aagaaatctggcattcaattacgtacccgtgatgggtttattataattgtaatgttttgg
attttgttttctgttattagtgcattccctttatggattgactcagaacttaatttaacg
ttcattgatgctctgtttgaaggggtttctggaataacaacaacaggagcaactgtaatt
gatgatgttagttcattacctcgggcatatttgtactatcggtcacagttaaattttata
ggtggtttaggagttattgttctggcggttgctgtattgccattattgggtattggtggt
gcaaagctttatcagtcagaaatgccggggccatttaaggatgacaaactcactccccgc
ctggccgatacgtcacggacactgtggataacttattctttattaggtattgcttgtatt
gtctgttatagacttgcaggaatgcctttgtttgatgctatttgtcacgggatttccaca
gtttcgcttggtggtttctcaactcatagcgagagtatcggatattttaataactatttg
gttgagctggtggctggttctttttccctgctatcggctttcaacttcactctttggtat
attgttattagcaggaaaacgataaaacctttaatcagagatattgaacttcgtttcttt
ctgttaatagccttaggggtgatcattgttacctctttccaggtctggcatataggtatg
tatgacttgcatggaagttttattcattcgttttttcttgccagctccatgctcactgat
aatggtttagctacgcaggattatgcaagttggcccacgcacacgatagtgtttttgctg
ttgtcaagtttctttgggggatgtataggttcaacttgtggtggaattaagtcacttcga
tttcttatacttttcaaacaaagcaaacacgagataaatcagctttctcatcccagagcg
ttgttgagtgtaaatgtaggagggaagatagttacagatcgtgtaatgaggtctgtatgg
agtttcttttttctttatactctcttcacggtgttttttatactggtgttaaatggtatg
ggatatgattttcttacatcatttgcaacagtggctgcatgtattaataatatgggatta
ggttttggggctactgcatcgtcattcggagtgcttaatgacattgcaaaatgcttaatg
tgcatagctatgattcttggtcgccttgaaatttatcctgttattatattgttttcaggt
tttttttggcgctcctaa
              
                            

Download fasta file
RegulonDB