RegulonDB RegulonDB 10.9: Gene Sequence
trpA gene sequence


Size: 807        A: 184  T: 191  G: 217  C: 215

Fasta

 

>trpA E. coli K12. Version NC_000913.3 GI:556503834
atggaacgctacgaatctctgtttgcccagttgaaggagcgcaaagaaggcgcattcgtt
cctttcgtcacgctcggtgatccgggcattgagcagtcattgaaaattatcgatacgcta
attgaagccggtgctgacgcgctggagttaggtatccccttctccgacccactggcggat
ggcccgacgattcaaaacgccactctgcgcgcctttgcggcaggtgtgactccggcacaa
tgttttgaaatgctggcactgattcgccagaaacacccgaccattcccattggcctgttg
atgtatgccaatctggtgtttaacaaaggcattgatgagttttatgcccagtgcgaaaaa
gtcggcgtcgattcggtgctggttgccgatgtgccagttgaagagtccgcgcccttccgc
caggccgcgttgcgtcataatgtcgcacctatcttcatctgcccgccaaatgccgatgac
gacctgctgcgccagatagcctcttacggtcgtggttacacctatttgctgtcacgagca
ggcgtgaccggcgcagaaaaccgcgccgcgttacccctcaatcatctggttgcgaagctg
aaagagtacaacgctgcacctccattgcagggatttggtatttccgccccggatcaggta
aaagcagcgattgatgcaggagctgcgggcgcgatttctggttcggccattgttaaaatc
atcgagcaacatattaatgagccagagaaaatgctggcggcactgaaagtttttgtacaa
ccgatgaaagcggcgacgcgcagttaa
              
                            

Download fasta file
RegulonDB