RegulonDB RegulonDB 10.9: Gene Sequence
trpB gene sequence


Size: 1194        A: 283  T: 258  G: 336  C: 317

Fasta

 

>trpB E. coli K12. Version NC_000913.3 GI:556503834
atgacaacattacttaacccctattttggtgagtttggcggcatgtacgtgccacaaatc
ctgatgcctgctctgcgccagctggaagaagcttttgtcagtgcgcaaaaagatcctgaa
tttcaggctcagttcaacgacctgctgaaaaactatgccgggcgtccaaccgcgctgacc
aaatgccagaacattacagccgggacgaacaccacgctgtatctcaagcgtgaagatttg
ctgcacggcggcgcgcataaaactaaccaggtgctggggcaggcgttgctggcgaagcgg
atgggtaaaaccgaaatcatcgccgaaaccggtgccggtcagcatggcgtggcgtcggcc
cttgccagcgccctgctcggcctgaaatgccgtatttatatgggtgccaaagacgttgaa
cgccagtcgcctaacgtttttcgtatgcgcttaatgggtgcggaagtgatcccggtgcat
agcggttccgcgacgctgaaagatgcctgtaacgaggcgctgcgcgactggtccggtagt
tacgaaaccgcgcactatatgctgggcaccgcagctggcccgcatccttatccgaccatt
gtgcgtgagtttcagcggatgattggcgaagaaaccaaagcgcagattctggaaagagaa
ggtcgcctgccggatgccgttatcgcctgtgttggcggcggttcgaatgccatcggcatg
tttgctgatttcatcaatgaaaccaacgtcggcctgattggtgtggagccaggtggtcac
ggtatcgaaactggcgagcacggcgcaccgctaaaacatggtcgcgtgggtatctatttc
ggtatgaaagcgccgatgatgcaaaccgaagacgggcagattgaagaatcttactccatc
tccgccggactggatttcccgtctgtcggcccacaacacgcgtatcttaacagcactgga
cgcgctgattacgtgtctattaccgatgatgaagcccttgaagccttcaaaacgctgtgc
ctgcacgaagggatcatcccggcgctggaatcctcccacgccctggcccatgcgttgaaa
atgatgcgcgaaaacccggataaagagcagctactggtggttaacctttccggtcgcggc
gataaagacatcttcaccgttcacgatattttgaaagcacgaggggaaatctga
              
                            

Download fasta file
RegulonDB