RegulonDB RegulonDB 10.9: Gene Sequence
trpC gene sequence


Size: 1362        A: 315  T: 328  G: 388  C: 331

Fasta

 

>trpC E. coli K12. Version NC_000913.3 GI:556503834
atgatgcaaaccgttttagcgaaaatcgtcgcagacaaggcgatttgggtagaagcccgc
aaacagcagcaaccgctggccagttttcagaatgaggttcagccgagcacgcgacatttt
tatgatgcgctacagggtgcgcgcacggcgtttattctggagtgcaagaaagcgtcgccg
tcaaaaggcgtgatccgtgatgatttcgatccagcacgcattgccgccatttataaacat
tacgcttcggcaatttcggtgctgactgatgagaaatattttcaggggagctttaatttc
ctccccatcgtcagccaaatcgccccgcagccgattttatgtaaagacttcattatcgac
ccttaccagatctatctggcgcgctattaccaggccgatgcctgcttattaatgctttca
gtactggatgacgaccaatatcgccagcttgccgccgtcgctcacagtctggagatgggg
gtgctgaccgaagtcagtaatgaagaggaacaggagcgcgccattgcattgggagcaaag
gtcgttggcatcaacaaccgcgatctgcgtgatttgtcgattgatctcaaccgtacccgc
gagcttgcgccgaaactggggcacaacgtgacggtaatcagcgaatccggcatcaatact
tacgctcaggtgcgcgagttaagccacttcgctaacggttttctgattggttcggcgttg
atggcccatgacgatttgcacgccgccgtgcgccgggtgttgctgggtgagaataaagta
tgtggcctgacgcgtgggcaagatgctaaagcagcttatgacgcgggcgcgatttacggt
gggttgatttttgttgcgacatcaccgcgttgcgtcaacgttgaacaggcgcaggaagtg
atggctgcggcaccgttgcagtatgttggcgtgttccgcaatcacgatattgccgatgtg
gtggacaaagctaaggtgttatcgctggcggcagtgcaactgcatggtaatgaagaacag
ctgtatatcgatacgctgcgtgaagctctgccagcacatgttgccatctggaaagcatta
agcgtcggtgaaaccctgcccgcccgcgagtttcagcacgttgataaatatgttttagac
aacggccagggtggaagcgggcaacgttttgactggtcactattaaatggtcaatcgctt
ggcaacgttctgctggcggggggcttaggcgcagataactgcgtggaagcggcacaaacc
ggctgcgccggacttgattttaattctgctgtagagtcgcaaccgggcatcaaagacgca
cgtcttttggcctcggttttccagacgctgcgcgcatattaa
              
                            

Download fasta file
RegulonDB