RegulonDB RegulonDB 10.9: Gene Sequence
trpD gene sequence


Size: 1596        A: 356  T: 340  G: 455  C: 445

Fasta

 

>trpD E. coli K12. Version NC_000913.3 GI:556503834
atggctgacattctgctgctcgataatatcgactcttttacgtacaacctggcagatcag
ttgcgcagcaatgggcataacgtggtgatttaccgcaaccatattccggcgcaaacctta
attgaacgcctggcgaccatgagcaatccggtgctgatgctttctcctggccccggtgtg
ccgagcgaagccggttgtatgccggaactcctcacccgcttgcgtggcaagctgcccatt
attggcatttgcctcggacatcaggcgattgtcgaagcttacgggggctatgtcggtcag
gcgggcgaaattctccacggtaaagcctccagcattgaacatgacggtcaggcgatgttt
gccggattaacaaacccgctgccggtggcgcgttatcactcgctggttggcagtaacatt
ccggccggtttaaccatcaacgcccattttaatggcatggtgatggcagtacgtcacgat
gcggatcgcgtttgtggattccagttccatccggaatccattctcaccacccagggcgct
cgcctgctggaacaaacgctggcctgggcgcagcagaaactagagccagccaacacgctg
caaccgattctggaaaaactgtatcaggcgcagacgcttagccaacaagaaagccaccag
ctgttttcagcggtggtgcgtggcgagctgaagccggaacaactggcggcggcgctggtg
agcatgaaaattcgcggtgagcacccgaacgagatcgccggggcagcaaccgcgctactg
gaaaacgcagcgccgttcccgcgcccggattatctgtttgctgatatcgtcggtactggc
ggtgacggcagcaacagtatcaatatttctaccgccagtgcgtttgtcgccgcggcctgt
gggctgaaagtggcgaaacacggcaaccgtagcgtctccagtaaatctggttcgtccgat
ctgctggcggcgttcggtattaatcttgatatgaacgccgataaatcgcgccaggcgctg
gatgagttaggtgtatgtttcctctttgcgccgaagtatcacaccggattccgccacgcg
atgccggttcgccagcaactgaaaacccgcaccctgttcaatgtgctggggccattgatt
aacccggcgcatccgccgctggcgttaattggtgtttatagtccggaactggtgctgccg
attgccgaaaccttgcgcgtgctggggtatcaacgcgcggcggtggtgcacagcggcggg
atggatgaagtttcattacacgcgccgacaatcgttgccgaactgcatgacggcgaaatt
aaaagctatcagctcaccgcagaagactttggcctgacaccctaccaccaggagcaactg
gcaggcggaacaccggaagaaaaccgtgacattttaacacgtttgttacaaggtaaaggc
gacgccgcccatgaagcagccgtcgctgcgaacgtcgccatgttaatgcgcctgcatggc
catgaagatctgcaagccaatgcgcaaaccgttcttgaggtactgcgcagtggttccgct
tacgacagagtcaccgcactggcggcacgagggtaa
              
                            

Download fasta file
RegulonDB