RegulonDB RegulonDB 10.9: Gene Sequence
trpE gene sequence


Size: 1563        A: 345  T: 368  G: 411  C: 439

Fasta

 

>trpE E. coli K12. Version NC_000913.3 GI:556503834
atgcaaacacaaaaaccgactctcgaactgctaacctgcgaaggcgcttatcgcgacaat
cccaccgcgctttttcaccagttgtgtggggatcgtccggcaacgctgctgctggaatcc
gcagatatcgacagcaaagatgatttaaaaagcctgctgctggtagacagtgcgctgcgc
attacagctttaggtgacactgtcacaatccaggcactttccggcaacggcgaagccctc
ctggcactactggataacgccctgcctgcgggtgtggaaagtgaacaatcaccaaactgc
cgtgtgctgcgcttcccccctgtcagtccactgctggatgaagacgcccgcttatgctcc
ctttcggtttttgacgctttccgtttattgcagaatctgttgaatgtaccgaaggaagaa
cgagaagccatgttcttcggcggcctgttctcttatgaccttgtggcgggatttgaagat
ttaccgcaactgtcagcggaaaataactgccctgatttctgtttttatctcgctgaaacg
ctgatggtgattgaccatcagaaaaaaagcacccgtattcaggccagcctgtttgctccg
aatgaagaagaaaaacaacgtctcactgctcgcctgaacgaactacgtcagcaactgacc
gaagccgcgccgccgctgccagtggtttccgtgccgcatatgcgttgtgaatgtaatcag
agcgatgaagagttcggtggcgtagtgcgtttgttgcaaaaagcgattcgcgctggagaa
attttccaggtggtgccatctcgccgtttctctctgccctgcccgtcaccgctggcggcc
tattacgtgctgaaaaagagtaatcccagcccgtacatgttttttatgcaggataatgat
ttcaccctatttggcgcgtcgccggaaagctcgctcaagtatgatgccaccagccgccag
attgagatctacccgattgccggaacacgcccacgcggtcgtcgcgccgatggttcactg
gacagagatctcgacagccgtattgaactggaaatgcgtaccgatcataaagagctgtct
gaacatctgatgctggttgatctcgcccgtaatgatctggcacgcatttgcacccccggc
agccgctacgtcgccgatctcaccaaagttgaccgttattcctatgtgatgcacctcgtc
tctcgcgtagtcggcgaactgcgtcacgatcttgacgccctgcacgcttatcgcgcctgt
atgaatatggggacgttaagcggtgcgccgaaagtacgcgctatgcagttaattgccgag
gcggaaggtcgtcgccgcggcagctacggcggcgcggtaggttatttcaccgcgcatggc
gatctcgacacctgcattgtgatccgctcggcgctggtggaaaacggtatcgccaccgtg
caagcgggtgctggtgtagtccttgattctgttccgcagtcggaagccgacgaaacccgt
aacaaagcccgcgctgtactgcgcgctattgccaccgcgcatcatgcacaggagactttc
tga
              
                            

Download fasta file
RegulonDB