RegulonDB RegulonDB 10.10: Gene Sequence
trxB gene sequence


Size: 966        A: 237  T: 211  G: 257  C: 261

Fasta

 

>trxB E. coli K12. Version NC_000913.3 GI:556503834
atgggcacgaccaaacacagtaaactgcttatcctgggttcaggcccggcgggatacacc
gctgctgtctacgcggcgcgcgccaacctgcaacctgtgctgattaccggcatggaaaaa
ggcggccaactgaccaccaccacggaagtggaaaactggcctggcgatccaaacgatctg
accggtccgttattaatggagcgcatgcacgaacatgccaccaagtttgaaactgagatc
atttttgatcatatcaacaaggtggatctgcaaaaccgtccgttccgtctgaatggcgat
aacggcgaatacacttgcgacgcgctgattattgccaccggagcttctgcacgctatctc
ggcctgccctctgaagaagcctttaaaggccgtggggtttctgcttgtgcaacctgcgac
ggtttcttctatcgcaaccagaaagttgcggtcatcggcggcggcaataccgcggttgaa
gaggcgctgtatctgtctaacatcgcttcggaagtgcatctgattcaccgccgtgacggt
ttccgcgcggaaaaaatcctcattaagcgcctgatggataaagtggagaacggcaacatc
attctgcacaccaaccgtacgctggaagaagtgaccggcgatcaaatgggtgtcactggc
gttcgtctgcgcgatacgcaaaacagcgataacatcgagtcactcgacgttgccggtctg
tttgttgctatcggtcacagcccgaatactgcgattttcgaagggcagctggaactggaa
aacggctacatcaaagtacagtcgggtattcatggtaatgccacccagaccagcattcct
ggcgtctttgccgcaggcgacgtgatggatcacatttatcgccaggccattacttcggcc
ggtacaggctgcatggcagcacttgatgcggaacgctacctcgatggtttagctgacgca
aaataa
              
                            

Download fasta file
RegulonDB